ID: 946885687

View in Genome Browser
Species Human (GRCh38)
Location 2:224220236-224220258
Sequence CAGTTTGTCCAGCTTTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946885686_946885687 -3 Left 946885686 2:224220216-224220238 CCAATTACTTCAAATCTAGACAG No data
Right 946885687 2:224220236-224220258 CAGTTTGTCCAGCTTTTACAAGG No data
946885684_946885687 25 Left 946885684 2:224220188-224220210 CCTAAATATTGTTTGACCAATTT No data
Right 946885687 2:224220236-224220258 CAGTTTGTCCAGCTTTTACAAGG No data
946885685_946885687 9 Left 946885685 2:224220204-224220226 CCAATTTCATCACCAATTACTTC No data
Right 946885687 2:224220236-224220258 CAGTTTGTCCAGCTTTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946885687 Original CRISPR CAGTTTGTCCAGCTTTTACA AGG Intergenic
No off target data available for this crispr