ID: 946885739

View in Genome Browser
Species Human (GRCh38)
Location 2:224220742-224220764
Sequence GAGAAAATGAGAGAGAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946885737_946885739 27 Left 946885737 2:224220692-224220714 CCAGCTTTACACAGATTTGCTCT No data
Right 946885739 2:224220742-224220764 GAGAAAATGAGAGAGAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946885739 Original CRISPR GAGAAAATGAGAGAGAATGT TGG Intergenic
No off target data available for this crispr