ID: 946885772

View in Genome Browser
Species Human (GRCh38)
Location 2:224221102-224221124
Sequence GCATCTCCATGGACTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946885772_946885776 2 Left 946885772 2:224221102-224221124 CCCTCAGCAGTCCATGGAGATGC No data
Right 946885776 2:224221127-224221149 GTTACAACCTTAACAGCATGAGG No data
946885772_946885777 5 Left 946885772 2:224221102-224221124 CCCTCAGCAGTCCATGGAGATGC No data
Right 946885777 2:224221130-224221152 ACAACCTTAACAGCATGAGGAGG No data
946885772_946885779 30 Left 946885772 2:224221102-224221124 CCCTCAGCAGTCCATGGAGATGC No data
Right 946885779 2:224221155-224221177 GAGAAAAACCCCACTATCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946885772 Original CRISPR GCATCTCCATGGACTGCTGA GGG (reversed) Intergenic