ID: 946889891

View in Genome Browser
Species Human (GRCh38)
Location 2:224264423-224264445
Sequence CACTTTCCAAGGATCTGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946889891_946889896 -9 Left 946889891 2:224264423-224264445 CCGTTTCAGATCCTTGGAAAGTG No data
Right 946889896 2:224264437-224264459 TGGAAAGTGTGTTTGGGGAGAGG No data
946889891_946889897 -3 Left 946889891 2:224264423-224264445 CCGTTTCAGATCCTTGGAAAGTG No data
Right 946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG No data
946889891_946889898 -2 Left 946889891 2:224264423-224264445 CCGTTTCAGATCCTTGGAAAGTG No data
Right 946889898 2:224264444-224264466 TGTGTTTGGGGAGAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946889891 Original CRISPR CACTTTCCAAGGATCTGAAA CGG (reversed) Intergenic
No off target data available for this crispr