ID: 946889897

View in Genome Browser
Species Human (GRCh38)
Location 2:224264443-224264465
Sequence GTGTGTTTGGGGAGAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946889891_946889897 -3 Left 946889891 2:224264423-224264445 CCGTTTCAGATCCTTGGAAAGTG No data
Right 946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946889897 Original CRISPR GTGTGTTTGGGGAGAGGAGC TGG Intergenic
No off target data available for this crispr