ID: 946894842

View in Genome Browser
Species Human (GRCh38)
Location 2:224313035-224313057
Sequence GGGGATAAAGTTATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946894842_946894849 -4 Left 946894842 2:224313035-224313057 CCTTCCTCCATAACTTTATCCCC No data
Right 946894849 2:224313054-224313076 CCCCCGGGAACATGGAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946894842 Original CRISPR GGGGATAAAGTTATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr