ID: 946902286

View in Genome Browser
Species Human (GRCh38)
Location 2:224384145-224384167
Sequence CTGTGGGACTGGGTGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 371}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946902286_946902291 -10 Left 946902286 2:224384145-224384167 CCCTCTGTCACCCAGTCCCACAG 0: 1
1: 0
2: 3
3: 38
4: 371
Right 946902291 2:224384158-224384180 AGTCCCACAGCCCCTCCACTGGG 0: 1
1: 0
2: 2
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946902286 Original CRISPR CTGTGGGACTGGGTGACAGA GGG (reversed) Intronic
900183768 1:1323912-1323934 CTGGGGGACTGGGGGGCTGAGGG + Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900272511 1:1798897-1798919 TTGTGAGTCTGGGTGACATAGGG - Intronic
901269563 1:7941450-7941472 CTCCGGGCATGGGTGACAGAGGG + Intronic
901365047 1:8739736-8739758 CTGTGGGACTTGATGACTGGAGG - Intronic
901552936 1:10009552-10009574 GGGTGACACTGGGTGACAGAGGG - Intronic
901798963 1:11696222-11696244 CTATGGGAAGGGGAGACAGAGGG - Intronic
903468965 1:23571971-23571993 GCCTGGGACTGGGGGACAGAAGG + Intergenic
904311545 1:29632677-29632699 CTGGGGGACTGAGGGACTGAGGG - Intergenic
904447598 1:30587550-30587572 CTGTGGGACTCTGGGACAGTCGG - Intergenic
904456440 1:30651065-30651087 CTGTGGGTCTGGGTGCCAAGTGG - Intergenic
904896895 1:33824380-33824402 CTCAGGGACTGGATGGCAGAGGG - Intronic
905471567 1:38196096-38196118 CTGTGTGACTGGGTGCCAAATGG + Intergenic
907325909 1:53638548-53638570 CTTTGGGATTGGGTGGCAGTGGG - Intronic
907927410 1:58967453-58967475 CTGTAGCAGTGGGTGACAGTTGG - Intergenic
908398174 1:63745463-63745485 CTGTGGGGCTGGGTGAGAGTGGG - Intergenic
909111171 1:71479562-71479584 ATGTAGGATTGGGTGTCAGAAGG - Intronic
909129440 1:71715884-71715906 CTTTGGAACTGGGTAACAGGCGG - Intronic
910159528 1:84258690-84258712 CAGAGGGACAGGGAGACAGAGGG - Intergenic
912579243 1:110705357-110705379 CTTTGGAACTGGGTAACAGGCGG - Intergenic
913050677 1:115114363-115114385 CTGTGGGACAGGATCACAGCAGG - Intergenic
913101623 1:115572960-115572982 CTTTGGAACTGGGTAACAGGTGG + Intergenic
915466658 1:156102328-156102350 CTCTGGGCCTGGGGTACAGAGGG + Intronic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
916745642 1:167683027-167683049 CTGTGTGTCTTGGTGACAAATGG + Intronic
917171223 1:172177020-172177042 CAGTAGGACTTGGTGACTGAAGG + Intronic
917535591 1:175872191-175872213 CTGGGGAACTGGGGGACTGAGGG + Intergenic
917721375 1:177789508-177789530 CTGTGAGGCTGAGTGACAAAGGG - Intergenic
918026603 1:180755600-180755622 TTGTGGAAGTGGGTGTCAGAAGG - Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918412455 1:184273754-184273776 CTATGAGACTGAGTAACAGAGGG + Intergenic
918528941 1:185496137-185496159 GCCTGGGTCTGGGTGACAGATGG + Intergenic
919005554 1:191895069-191895091 CTGTGTGACTAGGTGAGAGGTGG - Intergenic
919374003 1:196768910-196768932 TTGAGGGACTGGGTCAGAGAAGG + Intergenic
919408236 1:197210513-197210535 CTGTGGGACAGGTCCACAGATGG - Intergenic
920446292 1:206021225-206021247 CTGTGGGGCTGGGTGGCATTAGG - Intronic
920597829 1:207291051-207291073 CTTTGGAACTGGGTAACAGGCGG + Intergenic
921262286 1:213394945-213394967 CTGTGGAACTTATTGACAGAGGG + Intergenic
922272888 1:224050814-224050836 CTGTTGGACTGCCTGCCAGATGG - Intergenic
924101524 1:240608069-240608091 CTGTAGGACTGACTGACTGAAGG + Intronic
924768217 1:247053806-247053828 CTATGGGCATGGATGACAGATGG - Intronic
1062805370 10:415944-415966 CTGTGGGACTGTGGGACTGTGGG - Intronic
1062920252 10:1273878-1273900 CTCTGGGACCGGGTGACGGGTGG + Intronic
1062963712 10:1592238-1592260 CAGGGGAGCTGGGTGACAGAGGG - Intronic
1062963994 10:1593309-1593331 CAGGGGAGCTGGGTGACAGAGGG - Intronic
1065768621 10:29055781-29055803 CTTTAGGACTGGGTGGCAAAAGG - Intergenic
1066350936 10:34636316-34636338 GTGTGGGTTTGGATGACAGAGGG - Intronic
1066604796 10:37153577-37153599 CTGTGAGACTGTTTCACAGAAGG + Exonic
1066605620 10:37166610-37166632 CTGTGAGACTGTTTCACAGAAGG + Exonic
1066606335 10:37177671-37177693 CTGTGAGACTGTTTCACAGAAGG + Intronic
1066607119 10:37189472-37189494 CTGTGAGACTGTTTCACAGAAGG + Exonic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1070173804 10:73953502-73953524 CAGTTGGACTGGGTGAGAAAGGG + Intergenic
1070250446 10:74768495-74768517 CCATTGCACTGGGTGACAGAGGG + Intergenic
1070513380 10:77181100-77181122 CTGTGGGCCTGGGTGATGGAAGG - Intronic
1070890385 10:79938683-79938705 CTGTTGTACAGGGTGACAGTGGG - Intronic
1070971230 10:80569169-80569191 TTGTGGGACTGGGAGACTCAGGG + Intronic
1072581557 10:96744459-96744481 CTGTGTGACTTGGTTTCAGAAGG + Intergenic
1072606957 10:96992503-96992525 TTGTGGGATGGGGTGACAGTGGG - Intergenic
1072742742 10:97919799-97919821 CAGTGAGCCTGAGTGACAGAGGG - Intronic
1072963303 10:99950419-99950441 CTTTGGAACTGGGTAACAGGCGG + Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073184350 10:101606812-101606834 CTGGGGGAATGGGTGTGAGAAGG + Intronic
1074008706 10:109455746-109455768 CTGAGGGAGTGGGTGCCAGTGGG - Intergenic
1074358443 10:112806149-112806171 CTGAGGGACTGGGACACAGTGGG - Intronic
1074387251 10:113026495-113026517 TTGTGGAGCTGGCTGACAGAAGG - Intronic
1075358926 10:121811989-121812011 CTATCAGTCTGGGTGACAGAGGG - Intronic
1075646385 10:124099567-124099589 CTGTGGGTGTGGGTGAGAGCTGG + Intergenic
1075699064 10:124456852-124456874 GTGTGGGAGTGGATGACACAGGG - Intergenic
1075813324 10:125244830-125244852 CTGTGGGTGTGGGTGACAGTTGG + Intergenic
1076202424 10:128569178-128569200 CTGGGGGTCTTGGTGGCAGATGG - Intergenic
1076302258 10:129437243-129437265 CTCTGGGGCTGGGTGGTAGAAGG - Intergenic
1076880847 10:133238393-133238415 CTGAGGAACGGGGTGACAAAAGG - Intronic
1077289637 11:1782944-1782966 CTCTGGGAATGGGAGACACAGGG + Intergenic
1077303097 11:1856124-1856146 CTGTGGGACAGGGTGGCGGCAGG - Intronic
1077648374 11:3946855-3946877 CTGTGTGACTGTGTGACATTGGG + Intronic
1077930060 11:6721539-6721561 CTGAGGGACTTGCTGACAGAAGG - Intergenic
1078771984 11:14359341-14359363 GTGTGGGAGTGGGTGTCAGTTGG + Intronic
1079943806 11:26716082-26716104 CTTTGGTACTGGGTGGCACAAGG + Intronic
1081496184 11:43612860-43612882 CTGTGGAACTGGGTGAGAAATGG + Intronic
1081551668 11:44119211-44119233 CTGTGGGGATGTGTGTCAGAGGG + Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083887890 11:65581607-65581629 CTGGGGGACTGGGGGCCGGAGGG - Exonic
1084915604 11:72426710-72426732 CTGTGGAACAGGGTAAAAGACGG + Intronic
1087923994 11:103898656-103898678 CTATGGTAATAGGTGACAGAAGG - Intergenic
1089866178 11:121634173-121634195 CTGTGGAACTGGGTGGGGGAGGG + Intergenic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092795199 12:12103975-12103997 CTGGGTGACTGGGTGACAGAGGG + Intronic
1092808170 12:12246637-12246659 CAGTGAGCCTGGGTGACAGAGGG + Intronic
1093834003 12:23803406-23803428 TAATGGGACTTGGTGACAGATGG - Intronic
1095950069 12:47776966-47776988 CTGTGGCACGAGGAGACAGAGGG + Intronic
1096886981 12:54727909-54727931 CTTTGGAACTGGGTAACAGGAGG - Intergenic
1097249229 12:57623260-57623282 CTGTGAGAAAGGGTGACTGAGGG + Intronic
1098743263 12:74201375-74201397 CTTTGGAACTGGGTAACAGATGG - Intergenic
1102543924 12:113641338-113641360 ATGGGGGACTGGGGGACATAGGG - Intergenic
1102812078 12:115832951-115832973 TTGTTGGAATGAGTGACAGAGGG - Intergenic
1103673260 12:122635637-122635659 CTGTGGGGCAGGGTGAGAGGAGG + Intergenic
1104808156 12:131602743-131602765 CTTTGGAACTGGATGACAGGTGG - Intergenic
1106882590 13:34148253-34148275 CTGTGGGAGAGGGTGGCACATGG - Intergenic
1109208410 13:59506954-59506976 CTCTGGGTTTGGGTGACTGAGGG - Intergenic
1109297609 13:60553406-60553428 CTTTGGAACTGGGTAACAGGCGG - Intronic
1109747696 13:66647926-66647948 CTGTGGGCCTGGGGAAGAGACGG + Intronic
1110342070 13:74403330-74403352 CTTTGGAACTGGGTAACAGGTGG - Intergenic
1111213456 13:85110978-85111000 CTTTGGGACGGCATGACAGATGG - Intergenic
1112101165 13:96190902-96190924 CAGTGGGGCTGAGTGACACAAGG + Intronic
1112265548 13:97920224-97920246 CGGTGGGAGTGGGGGACAGGGGG - Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113943609 13:114031829-114031851 CTGTGGGAGGGTGGGACAGACGG + Intronic
1116883521 14:50195701-50195723 CAGTGAGCCTGGGTGACAGAGGG + Intronic
1117066688 14:52018523-52018545 ATGTTGGGCTGGGTTACAGAGGG + Intronic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1119266964 14:73268495-73268517 CTGGAGGTCTGGGAGACAGAGGG - Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119485646 14:74984915-74984937 CTGTGGGACTTGGGGACTGAGGG + Intergenic
1119572760 14:75690654-75690676 CTGTGGTTCTGGGCTACAGAGGG - Intronic
1119738915 14:77001244-77001266 CTGTGGGATGGGGTAACAGAGGG - Intergenic
1121036078 14:90704668-90704690 CACTGGGAGTGGGTGACAAAGGG + Intronic
1121099802 14:91242601-91242623 ATGAGGGAATGGGTGGCAGATGG + Intronic
1121586860 14:95068547-95068569 CTTGGGGACTGGGGGACAGCTGG + Intergenic
1121789360 14:96687321-96687343 CTGTGTGCCGTGGTGACAGAGGG - Intergenic
1122154277 14:99741144-99741166 CTGTGAGCCTCTGTGACAGATGG + Intronic
1122564809 14:102645590-102645612 CTTTGGGGCTGGGTGGCAGGTGG - Intronic
1122930846 14:104932509-104932531 CTGTGGGGCCAGGTGACAGGCGG - Intronic
1126423300 15:48498759-48498781 CTGTGGGACTTGGCCACTGAGGG - Intronic
1127163199 15:56213667-56213689 CTGGGGGACTGGGTAATAAAGGG + Intronic
1128081682 15:64860842-64860864 CTGAGGGACAGAGGGACAGAGGG + Intronic
1129832346 15:78679199-78679221 CTGGGTGACTGGGTGCCAGGAGG + Intronic
1129918271 15:79294207-79294229 CTCTGTGACTGTGTGAAAGAGGG - Exonic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1131298323 15:91172215-91172237 CTGTGGGACAGGGATGCAGAGGG - Intronic
1131387066 15:92016743-92016765 CAGGGGGAGTGAGTGACAGATGG + Intronic
1132422213 15:101680151-101680173 CTGTTGGAATGGGTAAGAGAAGG - Intronic
1132647819 16:1007180-1007202 CTTTGGTGCTGGGGGACAGAGGG + Intergenic
1133643877 16:7744640-7744662 CTGAGGGAATGGGAGACACAGGG - Intergenic
1134417479 16:14057004-14057026 CTGTGGAAATGGTTGACATAAGG + Intergenic
1136138671 16:28274848-28274870 ATGTGGGAGTGGGTGGGAGAGGG + Intergenic
1137017897 16:35394531-35394553 CTGTGGGACAGATGGACAGAGGG - Intergenic
1138339123 16:56277157-56277179 CTGGGGAATTGGGTGACTGAGGG + Intronic
1138679564 16:58675166-58675188 CTTTGGGAGTGGTTCACAGAAGG - Intronic
1139133761 16:64177570-64177592 CTTTGGAACTGGGTAACAGGCGG + Intergenic
1139561220 16:67743655-67743677 CTGCAGGGCTTGGTGACAGATGG - Intronic
1139756859 16:69150949-69150971 TTGTGGGACAGGGGGACACAGGG - Intronic
1140077946 16:71719678-71719700 CTATGGGCCTGGGTGACACAAGG + Intronic
1141013186 16:80422582-80422604 CTTTGGGACTTAGTGACTGAGGG - Intergenic
1141702101 16:85647216-85647238 CTTTGGGCCTGGGTGACTGGTGG - Intronic
1142667956 17:1473248-1473270 CTGGGGGACTGGGTCAAAGAAGG + Intronic
1143076818 17:4351139-4351161 CAGTGAGCCTGGCTGACAGAGGG + Intronic
1143450452 17:7033528-7033550 CTGTGGCACAGGGTGTCACATGG + Intergenic
1143526950 17:7478738-7478760 CTGTGGCTTTGGGTGACAGATGG - Intronic
1143880389 17:10025415-10025437 CTTGGGGACTGGGAGACAGGAGG - Intronic
1143993014 17:10982759-10982781 CTGTGGTACTTTGTTACAGAAGG - Intergenic
1144463311 17:15476099-15476121 TTTTGGGACTGGGTGACATGTGG - Intronic
1144499248 17:15770987-15771009 CGATGGGCCTGGGTCACAGAGGG - Intergenic
1144833298 17:18143624-18143646 GTGTGGGTCTGGGTGGCAGCAGG + Intronic
1145162639 17:20586020-20586042 CGATGGGCCTGGGTCACAGAGGG - Intergenic
1146624227 17:34423857-34423879 CTTTGGGACTGCGTGACACTCGG + Intergenic
1147256483 17:39185051-39185073 ATGTGGGAATGGGTGTTAGAAGG + Intronic
1147842671 17:43383041-43383063 CTCTGGGACTTGATGACTGAAGG + Intergenic
1148852014 17:50560150-50560172 CTGCGGGACTGGGGGAGGGAAGG - Intergenic
1150662378 17:67094287-67094309 CCTTGCGCCTGGGTGACAGAGGG + Intronic
1151537037 17:74744942-74744964 CTGTGGGACAGGGTGAAGGGTGG + Intronic
1151793181 17:76322960-76322982 CTGCAGGTCTGGGTGAGAGAGGG + Intronic
1151963550 17:77419750-77419772 CTGTGGGCTCGGGTTACAGATGG + Intronic
1152408228 17:80109361-80109383 CTGTGGGACTGGCTCAGGGAAGG - Intergenic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152844874 17:82593564-82593586 CTGTGGGGCCGGGAGCCAGAAGG - Intronic
1153012092 18:548443-548465 CTTTGGAACTGGGTAACAGGCGG - Intergenic
1153315286 18:3715232-3715254 CTGTTGGAATGGGTGAGAAATGG + Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1155443461 18:25885411-25885433 CTGTGGGCCTGGGTTAGTGATGG + Intergenic
1156088674 18:33440291-33440313 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088678 18:33440299-33440321 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088682 18:33440307-33440329 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156088686 18:33440315-33440337 CTGGGGGACTGGGGGACTGGGGG + Intronic
1156259094 18:35428085-35428107 GTCTGTGACTGGGTGAGAGACGG - Intergenic
1156464563 18:37340574-37340596 CTGTGGGACTGGGAGACGAGAGG - Intronic
1156911268 18:42413749-42413771 CCGTGGGACAGGGAGGCAGATGG - Intergenic
1158127290 18:54115158-54115180 CTTTGTGCCTGGGTGACACATGG - Intergenic
1159168149 18:64727859-64727881 CTGTGGGGCTTGGTTGCAGAAGG + Intergenic
1160297709 18:77653670-77653692 ATGTGGGACCGGGAGACACAGGG - Intergenic
1160337671 18:78057150-78057172 CTTTGGAACTGGGTAACAGGGGG + Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160851633 19:1195572-1195594 GTGAGGGCCTGGGTTACAGATGG - Intronic
1160851657 19:1195646-1195668 GTGAGGGCCTGGGTTACAGATGG - Intronic
1160852057 19:1197386-1197408 GTGAGGGCCTGGGTTACAGATGG - Intronic
1160852081 19:1197460-1197482 GTGAGGGCCTGGGTTACAGATGG - Intronic
1160989961 19:1856486-1856508 CTGTTGGTCTTGGTGACAGCTGG - Intronic
1161159866 19:2755840-2755862 CTGTTGGACTGCCTGAGAGAGGG - Exonic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1162458738 19:10801967-10801989 CTGTGGAATGGGGTGACAGGAGG - Intronic
1163571546 19:18085099-18085121 GTGTGGAACTGGGTGAGAGAAGG + Intronic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1164387275 19:27783677-27783699 CTGAGGGACTGGCTGTCAGGGGG + Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
1167671562 19:50856491-50856513 CCTTGGGACTGGGGGAGAGAGGG + Intronic
925146822 2:1587732-1587754 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925146883 2:1587941-1587963 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925259792 2:2519564-2519586 CCCTGGGACTGGGTCCCAGACGG + Intergenic
926019491 2:9482820-9482842 CTGCGGGACGTGGTGACAGTAGG + Intronic
926099371 2:10104307-10104329 AGGTGGGACATGGTGACAGAGGG - Intergenic
928444938 2:31325620-31325642 GCCTGGGCCTGGGTGACAGAGGG - Intergenic
928959800 2:36912407-36912429 CTGTAGGACTTTGTGACACATGG - Intronic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929666828 2:43839839-43839861 GGGTGAGACAGGGTGACAGACGG + Intronic
930444207 2:51450346-51450368 CTTTGGAACTGGGTAACAAACGG + Intergenic
930867221 2:56133730-56133752 GTGTGAGCCTGGGTGACAGAGGG + Intergenic
931366138 2:61620781-61620803 CTTTGGGACTAGGTGGCAGGTGG - Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
933064947 2:77781026-77781048 CTTTGGAACTGGGTAACAGGCGG + Intergenic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935689666 2:105719439-105719461 CCATGAGACAGGGTGACAGAGGG + Intergenic
936286739 2:111187093-111187115 GTGTGAGAGGGGGTGACAGAGGG - Intergenic
936814919 2:116448310-116448332 TTGTGGGACTGAGTGTTAGAGGG + Intergenic
938100278 2:128493468-128493490 CTGGGGGCGTGGCTGACAGAAGG + Intergenic
938947594 2:136227202-136227224 CTGTGCAGCTGGGTGACAGATGG + Intergenic
940750919 2:157626488-157626510 CAGTGAAACTGTGTGACAGAAGG - Intronic
940894366 2:159066053-159066075 CTTTGGGAGTGGGTCAGAGAGGG + Intronic
945026880 2:205628118-205628140 GTGTGTGACTGGGTGGTAGAGGG + Intergenic
945120898 2:206455975-206455997 CTTTGGAACTGGGTAACAGGCGG - Intronic
945239179 2:207660720-207660742 CTATGGGACATGGTGAGAGACGG + Intergenic
945538645 2:211054132-211054154 CTGTGGGACTGTGTAATTGAAGG + Intergenic
946108352 2:217391762-217391784 CTTTGGAACTGGGTAACAGGCGG - Intronic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
948782512 2:240330591-240330613 GTGTGGGACTTGGAGACAGCTGG - Intergenic
1170229485 20:14028739-14028761 CACTGGGACTGGTTGACAGAGGG - Intronic
1171975900 20:31594462-31594484 CTGTGGGAGTGGGTGCCTGCAGG + Intergenic
1172296904 20:33818630-33818652 ATGTGGGATTTGGGGACAGAAGG + Intronic
1172368963 20:34372278-34372300 CTGGGCGACAGAGTGACAGAGGG + Intronic
1173127833 20:40356351-40356373 ATGTGGGACTTGGGGACAGGAGG + Intergenic
1173229802 20:41185333-41185355 GTGGGGGAGTGGGTGGCAGAAGG - Intronic
1173600200 20:44289532-44289554 CAGTGGCAGTGGGTGACTGAAGG - Intergenic
1173801809 20:45898832-45898854 CTGTGGCACTGGGGGTTAGAGGG + Exonic
1173940604 20:46907800-46907822 CTGCCAGCCTGGGTGACAGAGGG + Intronic
1174090648 20:48044368-48044390 CTAAGGGACCAGGTGACAGAAGG + Intergenic
1174411757 20:50341053-50341075 ATGTGGGACTGTGGGACAGGAGG - Intergenic
1174448279 20:50604731-50604753 CCGTGGGGCTGGGTGACACCAGG + Exonic
1175828464 20:61949805-61949827 CTGTGGTACTGGGTGGGGGAAGG + Intergenic
1176285189 21:5015700-5015722 CTGTGGGGCTGGGTGAGCGGGGG + Intergenic
1177515581 21:22147414-22147436 CTTTGGAACTGGGTAACAGGAGG + Intergenic
1179102605 21:38367567-38367589 TTCTGGGACTGGGTCATAGAAGG - Intergenic
1179658993 21:42862789-42862811 CACTGGGACTTGGTGACAGATGG - Intronic
1179871992 21:44247775-44247797 CTGTGGGGCTGGGTGAGCGGGGG - Intronic
1181591131 22:23885320-23885342 ATGCCAGACTGGGTGACAGAGGG + Exonic
1181669900 22:24421153-24421175 CTGTGGGACTGGGGTGCACATGG + Intronic
1181751546 22:24992317-24992339 CTGGGGGACAGGGTCTCAGATGG + Intronic
1182102723 22:27669492-27669514 CTGTGAGACAGTGAGACAGAGGG + Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182506642 22:30787907-30787929 CCGTGGGTCTTAGTGACAGACGG + Intronic
1182774851 22:32823472-32823494 CTTTGGGGCTGGGACACAGACGG - Intronic
1183277798 22:36912220-36912242 CTGTGGGACTGGGAGGCTGCGGG - Intergenic
1183464658 22:37973544-37973566 CTGTGGGACTGGGGCCCTGAGGG + Exonic
1183544091 22:38446458-38446480 CTGGGGGCCTGGGTGAGGGAGGG + Intronic
1183708654 22:39489855-39489877 AGCTGGGACTGGGTGTCAGAAGG - Exonic
1184191392 22:42897652-42897674 CTGAGGGACTGCCTGGCAGACGG + Intronic
1185408839 22:50672478-50672500 TTGGGGGCCTGGGTGACAGCGGG + Intergenic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
950101510 3:10359735-10359757 CTGTGGCTCTGGGTGCTAGACGG + Intronic
950408322 3:12818064-12818086 CTATGGGACTGTGGGATAGAAGG + Intronic
951611943 3:24499275-24499297 CCTGGGTACTGGGTGACAGAGGG + Intergenic
952940472 3:38440502-38440524 CTTTGGGACAGGATGATAGATGG - Intergenic
956173318 3:66450314-66450336 CTGTGGGAGTGTTTGACAAATGG - Intronic
957160418 3:76602301-76602323 CTTTGGAACTGGGTAACAGGCGG - Intronic
957306723 3:78467279-78467301 CTGAGGGACTGACTGATAGAAGG - Intergenic
957424634 3:80021858-80021880 CTTTGGAACTGGGTGATGGATGG - Intergenic
957914613 3:86672219-86672241 CTGGGGGACTGGGGGAAAGGAGG - Intergenic
958079538 3:88728660-88728682 CTGTGCATCTGGCTGACAGATGG + Intergenic
958609883 3:96411195-96411217 CTTTGGAACTGGGTGACAGGGGG - Intergenic
960944822 3:122958668-122958690 CTGGGGGACTGGGGCCCAGAGGG + Intronic
962573009 3:136730078-136730100 CAGAGGGCCTGGGTGACAGAGGG - Intronic
964427289 3:156567491-156567513 CTTTGGAACTGGGTAACAGGCGG + Intergenic
964527539 3:157631204-157631226 CTCTGGGGGTTGGTGACAGAGGG - Intronic
965991099 3:174819100-174819122 TTGTGCCACTGAGTGACAGAAGG - Intronic
966555726 3:181258194-181258216 CAGTGGAACTTGGTGAAAGATGG + Intergenic
966825812 3:183963995-183964017 CTGGGGAACTGGGTGACAAAGGG - Intronic
967075182 3:185995444-185995466 CTGCAGAACTGGGAGACAGAGGG + Intergenic
968811680 4:2802854-2802876 CTGTGGCACCCGCTGACAGATGG + Intronic
969134547 4:5019654-5019676 CTGGAGGAGGGGGTGACAGAGGG + Intergenic
969205002 4:5637118-5637140 GAGAGGGACTGCGTGACAGATGG + Intronic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
970176663 4:13346359-13346381 CTGTGTCACATGGTGACAGAGGG - Intergenic
971282285 4:25250730-25250752 GAGAGGGACTGGGTGAGAGAGGG + Intronic
972620796 4:40746623-40746645 CTGTGATACTGGGTGAAAGTTGG - Intergenic
973340162 4:48995320-48995342 CTGTGGGACAGGGTCACACAGGG + Intronic
974879460 4:67735976-67735998 CTGAGGGGAAGGGTGACAGAGGG + Intergenic
975840190 4:78465671-78465693 CCCTGGGACTAGGTCACAGAGGG + Intronic
976140330 4:81984930-81984952 CTGTGGGTTGGGGTGACAGATGG - Intronic
976286546 4:83376284-83376306 CTTTGGAACTGGGTAACAGGCGG - Intergenic
976974174 4:91146897-91146919 CTCTGGGAAAGGGAGACAGAGGG + Intronic
977179505 4:93856942-93856964 CTGTGGGAATGGGTGCCGGTGGG - Intergenic
978308994 4:107364704-107364726 CTTTGGAACTGGGTAACAGGAGG + Intergenic
980156760 4:129117384-129117406 CTATGGGGCTGGGGGACAGTGGG - Intergenic
980959438 4:139460143-139460165 TTGTGAGTCTGGGTGACAGGAGG + Intronic
981104448 4:140864622-140864644 CTGTGGGACTGGGGGACACTGGG + Exonic
984702074 4:182825064-182825086 CTGGGGGCCAGGGTGGCAGAGGG - Intergenic
985416659 4:189742177-189742199 TTGTGGGAGTGGGTGGCAAATGG + Intergenic
985640794 5:1062681-1062703 CTGGGGGGCTGGGGGACTGAGGG + Intronic
985640802 5:1062697-1062719 CTGAGGGACTGGGGGACTGGGGG + Intronic
987642455 5:20629601-20629623 CTTTGGAACTGGGTAACAGGTGG - Intergenic
987662355 5:20893814-20893836 CTTTGGAACTGGGTAACAGGCGG + Intergenic
987984798 5:25133263-25133285 CTTTGGAACTGGGTAACAGGTGG + Intergenic
988320008 5:29682928-29682950 CTGTGGCAGTGGGTAACAGTTGG - Intergenic
992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG + Intergenic
994561718 5:101382363-101382385 CTTTGGAACTGGGTAACAGATGG - Intergenic
994659392 5:102635384-102635406 CTGGGTGACAGGGTGGCAGAGGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
996557332 5:124792521-124792543 CTCTTGGCCTGGGTGACAGAGGG - Intergenic
996837069 5:127805078-127805100 GTGTGGGACTGGGAGAGGGAGGG - Intergenic
997196026 5:131980638-131980660 CTGTGGGGCTGGGAGGCTGAGGG - Intronic
997206144 5:132051361-132051383 CTGTGAGGCTGTCTGACAGATGG + Intergenic
998273164 5:140725629-140725651 CTGGGTGACAGGGTGACAGAGGG + Intergenic
999005075 5:147967060-147967082 CTATGGGTCTGCGTGACTGAAGG - Intergenic
999475462 5:151894176-151894198 CTGCATGACTAGGTGACAGAAGG - Intronic
1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG + Intergenic
1001850861 5:174963680-174963702 CTTTGGGACTGGGTGGGGGAAGG + Intergenic
1002190520 5:177475052-177475074 CTAAGGGAGTGGGTGACACATGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003141273 6:3473410-3473432 CTGTGGGGCTGAGTGAAGGAAGG + Intergenic
1004583095 6:16973387-16973409 CTTTGGGACTGGAAGACAGTGGG - Intergenic
1006401628 6:33821177-33821199 CTCAGGGCCTGGGTGACAGCAGG - Intergenic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1006993417 6:38235494-38235516 CAGTGGTACTGGGAGCCAGATGG - Intronic
1007115480 6:39340134-39340156 CTTTGGGACCTGGTGGCAGAGGG + Intronic
1007716789 6:43861015-43861037 CTGTGGGATTGTGTACCAGACGG - Intergenic
1007784733 6:44273081-44273103 CAGAGGGACTTGGTGAAAGAGGG - Exonic
1007936436 6:45736869-45736891 CTGAGGAAATGGGTCACAGAGGG - Intergenic
1008139368 6:47814202-47814224 TTGTGGAAGTGGATGACAGATGG + Intronic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1010123482 6:72406716-72406738 CTGTTGGGCTGGGTCAGAGAGGG - Intergenic
1012447758 6:99323955-99323977 CTGTGGGGTTGTGTGAGAGAAGG - Intronic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014357668 6:120432822-120432844 CCAAGGGAATGGGTGACAGATGG + Intergenic
1014692328 6:124577385-124577407 CTGTGTGCTTGGGGGACAGAAGG + Intronic
1014750938 6:125255289-125255311 CTGTGGGCCTGTGTAACTGATGG + Intronic
1015823667 6:137289788-137289810 CTGTGAGACTGGGAGAGAGAGGG + Intergenic
1016252447 6:142060422-142060444 ATTTGGGACTGGGTGAAAGCAGG + Intronic
1017399828 6:154047307-154047329 CTGAGGGCCTGGGTGCAAGATGG + Intronic
1017547649 6:155469077-155469099 CTTTGGAACTGGGTAACAGGTGG - Intergenic
1017769217 6:157632046-157632068 CTGTGGGACTCAGTGGCAGGGGG - Intronic
1019446066 7:1072003-1072025 CTGTGTGGCTGGGTGACTGTTGG - Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019795589 7:3045809-3045831 CTGTGGGTCTTGGTGTTAGAAGG - Intergenic
1020443041 7:8239534-8239556 CATTGGGACTGGTTGACAGTGGG + Intronic
1021753926 7:23832971-23832993 CTTTGGAACTGGGTAACAGGCGG + Intergenic
1022500200 7:30878011-30878033 CCGAGGGACTTGGGGACAGAAGG - Intronic
1024855924 7:53779151-53779173 CTGTGGAAATGGGGGACAGTGGG - Intergenic
1028261095 7:88666358-88666380 CTTTGGGACTGGATGACTGCAGG - Intergenic
1028941517 7:96526995-96527017 CTGTGGCACTGGTTGAGGGATGG - Intronic
1029115285 7:98233474-98233496 CTGTGGGCCTGGGTGTCGGGAGG - Exonic
1029541677 7:101186814-101186836 CTGGGGGACAGAGGGACAGAGGG - Intergenic
1030283267 7:107798917-107798939 TTGGGGGAGTGGGTGAGAGATGG + Intronic
1030297517 7:107943829-107943851 CTGTGTGTCTGTGTGAGAGATGG + Intronic
1031829873 7:126613628-126613650 CCAAGGGAATGGGTGACAGACGG + Intronic
1032453939 7:132057631-132057653 CTTTGGAACTGGGTAACAGGTGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034341722 7:150361529-150361551 CTGAGGGCTTGGGAGACAGAGGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1035054622 7:156026232-156026254 CTGTGCCACTGAGTGACAGAAGG - Intergenic
1035534655 8:381868-381890 GTGGGAGCCTGGGTGACAGAAGG - Intergenic
1036216912 8:6888135-6888157 CTGTGGGGCTTGGTGACTTAGGG + Intergenic
1037659190 8:20912567-20912589 CAGTAAGCCTGGGTGACAGAAGG - Intergenic
1037673352 8:21034310-21034332 GAGTGGGACTGGGAGACAGTAGG + Intergenic
1038668776 8:29564468-29564490 CTGTGCACCTGGGTGACAGAAGG - Intergenic
1039544011 8:38394811-38394833 CAGAGGCACTGGGTGACAGGGGG + Intronic
1039570510 8:38582610-38582632 CTGTGGTAGTGAATGACAGAGGG + Intergenic
1042521042 8:69711263-69711285 CTTTGGGACCTGGGGACAGAGGG - Intronic
1042604623 8:70533097-70533119 GAGTGGGAGTGGGTGACAGTAGG + Intergenic
1042717289 8:71788144-71788166 TTGTTGGACTGAGTGACAAAGGG + Intergenic
1043043730 8:75294810-75294832 GTGTGGGACCGGGTGACTAATGG - Intergenic
1043255713 8:78134536-78134558 TTGTGCTACTGGGTGACAAATGG + Intergenic
1043514217 8:80981249-80981271 CATTGGAACTGGGTTACAGAAGG - Intronic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1044173350 8:89084918-89084940 CTGGAAGCCTGGGTGACAGAGGG - Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1048936688 8:139363418-139363440 CCATGGGACGTGGTGACAGAGGG + Intergenic
1049435123 8:142583035-142583057 GTGTGAGGCTGGGGGACAGAAGG + Intergenic
1049959863 9:728223-728245 CTGGGTGACAGAGTGACAGAGGG - Intronic
1050106845 9:2174512-2174534 GTGTGGGACTTGGGCACAGATGG + Intronic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1053063758 9:35051947-35051969 CAGTGAGCCTGGGCGACAGATGG - Intergenic
1053380893 9:37649450-37649472 CCGTGGATCTGGGTGGCAGAGGG + Intronic
1054713360 9:68533336-68533358 CTGGGGGACTGGCTGACACCTGG - Intergenic
1055571329 9:77620013-77620035 CTGTTTGACTTGGTGACAAACGG - Intronic
1055643811 9:78343933-78343955 CTGTGAGACTGTATGTCAGAGGG + Intergenic
1056951429 9:91043466-91043488 CTGTGGGACTCGGTGTGGGAGGG - Intergenic
1056974538 9:91239467-91239489 CTGTGGGACTCTGTGTCAGATGG + Intronic
1057900471 9:98944220-98944242 CCGCGGGTCTGGGTGACAGCAGG - Exonic
1058056680 9:100455848-100455870 CTGTTGGACTGGTTCCCAGAGGG + Intronic
1059464431 9:114458765-114458787 GGGTGGGAGTGGGAGACAGAAGG + Intronic
1060749636 9:126160616-126160638 ATGTGGGCCTGGGGGACCGAGGG - Intergenic
1061360234 9:130136945-130136967 ACTTGGGACTGTGTGACAGAAGG + Exonic
1062004692 9:134233336-134233358 CTGTGACACTGGGAGACACAGGG + Intergenic
1062393064 9:136341646-136341668 CTTTGGGAGTGGGGGACACATGG - Intronic
1186513689 X:10150161-10150183 CTGTGGGACTTGGTTACGGCAGG - Intergenic
1187250127 X:17590191-17590213 CTGGGGGACTGTGTGGCAGTTGG + Intronic
1187450514 X:19392249-19392271 CTGAGTGACTGGCTGACAGAGGG - Intronic
1187843661 X:23514469-23514491 CTTTGGGAAGGTGTGACAGAGGG - Intergenic
1187912696 X:24125307-24125329 CTGTGGGACTTGGAGACTTAGGG + Intergenic
1189811748 X:44787546-44787568 CTGAGTGACTGAGTGACAGAGGG - Intergenic
1196296259 X:114000567-114000589 CTGGGGGACAGAGTGAAAGATGG + Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1198187077 X:134264012-134264034 CAGTGAGCCTGGGCGACAGAGGG + Intergenic
1199852555 X:151736119-151736141 CTGAGGGGCTGGGTGAGTGAAGG - Intergenic
1200064899 X:153499648-153499670 CTGTGGGAGTGGCTGCCTGAGGG - Intronic