ID: 946903504

View in Genome Browser
Species Human (GRCh38)
Location 2:224394564-224394586
Sequence ATTTGATGCTAACAGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2624
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 2599}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946903494_946903504 18 Left 946903494 2:224394523-224394545 CCCTCTGAAGTGGTCAGTCAAGC 0: 1
1: 0
2: 0
3: 7
4: 88
Right 946903504 2:224394564-224394586 ATTTGATGCTAACAGGATTATGG 0: 1
1: 0
2: 1
3: 23
4: 2599
946903498_946903504 -6 Left 946903498 2:224394547-224394569 CCCTTCCAACCTGTCCTATTTGA 0: 1
1: 0
2: 1
3: 27
4: 255
Right 946903504 2:224394564-224394586 ATTTGATGCTAACAGGATTATGG 0: 1
1: 0
2: 1
3: 23
4: 2599
946903499_946903504 -7 Left 946903499 2:224394548-224394570 CCTTCCAACCTGTCCTATTTGAT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 946903504 2:224394564-224394586 ATTTGATGCTAACAGGATTATGG 0: 1
1: 0
2: 1
3: 23
4: 2599
946903497_946903504 -5 Left 946903497 2:224394546-224394568 CCCCTTCCAACCTGTCCTATTTG 0: 1
1: 0
2: 2
3: 25
4: 244
Right 946903504 2:224394564-224394586 ATTTGATGCTAACAGGATTATGG 0: 1
1: 0
2: 1
3: 23
4: 2599
946903493_946903504 19 Left 946903493 2:224394522-224394544 CCCCTCTGAAGTGGTCAGTCAAG 0: 1
1: 0
2: 1
3: 12
4: 143
Right 946903504 2:224394564-224394586 ATTTGATGCTAACAGGATTATGG 0: 1
1: 0
2: 1
3: 23
4: 2599
946903496_946903504 -4 Left 946903496 2:224394545-224394567 CCCCCTTCCAACCTGTCCTATTT 0: 1
1: 0
2: 1
3: 30
4: 320
Right 946903504 2:224394564-224394586 ATTTGATGCTAACAGGATTATGG 0: 1
1: 0
2: 1
3: 23
4: 2599
946903495_946903504 17 Left 946903495 2:224394524-224394546 CCTCTGAAGTGGTCAGTCAAGCC 0: 1
1: 0
2: 0
3: 6
4: 120
Right 946903504 2:224394564-224394586 ATTTGATGCTAACAGGATTATGG 0: 1
1: 0
2: 1
3: 23
4: 2599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946903504 Original CRISPR ATTTGATGCTAACAGGATTA TGG Intronic
Too many off-targets to display for this crispr