ID: 946905059

View in Genome Browser
Species Human (GRCh38)
Location 2:224407692-224407714
Sequence TAGGAATCTCAGGTCCTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946905059_946905064 27 Left 946905059 2:224407692-224407714 CCAGCGAGGACCTGAGATTCCTA No data
Right 946905064 2:224407742-224407764 TTGAAGACAACAAGTAGCAATGG No data
946905059_946905062 -8 Left 946905059 2:224407692-224407714 CCAGCGAGGACCTGAGATTCCTA No data
Right 946905062 2:224407707-224407729 GATTCCTAAATTCTCAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946905059 Original CRISPR TAGGAATCTCAGGTCCTCGC TGG (reversed) Intergenic