ID: 946909098

View in Genome Browser
Species Human (GRCh38)
Location 2:224442710-224442732
Sequence CCGGTTCTGATGGGGTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946909091_946909098 -5 Left 946909091 2:224442692-224442714 CCTGGGGACCTGGTCCATCCGGT No data
Right 946909098 2:224442710-224442732 CCGGTTCTGATGGGGTCCGCAGG No data
946909089_946909098 4 Left 946909089 2:224442683-224442705 CCGAGGCTGCCTGGGGACCTGGT No data
Right 946909098 2:224442710-224442732 CCGGTTCTGATGGGGTCCGCAGG No data
946909081_946909098 26 Left 946909081 2:224442661-224442683 CCAAGACCGAGGACGCGCCGAGC No data
Right 946909098 2:224442710-224442732 CCGGTTCTGATGGGGTCCGCAGG No data
946909083_946909098 20 Left 946909083 2:224442667-224442689 CCGAGGACGCGCCGAGCCGAGGC No data
Right 946909098 2:224442710-224442732 CCGGTTCTGATGGGGTCCGCAGG No data
946909087_946909098 9 Left 946909087 2:224442678-224442700 CCGAGCCGAGGCTGCCTGGGGAC No data
Right 946909098 2:224442710-224442732 CCGGTTCTGATGGGGTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946909098 Original CRISPR CCGGTTCTGATGGGGTCCGC AGG Intergenic
No off target data available for this crispr