ID: 946910350

View in Genome Browser
Species Human (GRCh38)
Location 2:224454627-224454649
Sequence TCACTTTGCAAAGCTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946910345_946910350 26 Left 946910345 2:224454578-224454600 CCAAAGGCAGATTGGAAGCTCTG No data
Right 946910350 2:224454627-224454649 TCACTTTGCAAAGCTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946910350 Original CRISPR TCACTTTGCAAAGCTCTGGC TGG Intergenic
No off target data available for this crispr