ID: 946910351

View in Genome Browser
Species Human (GRCh38)
Location 2:224454628-224454650
Sequence CACTTTGCAAAGCTCTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946910345_946910351 27 Left 946910345 2:224454578-224454600 CCAAAGGCAGATTGGAAGCTCTG No data
Right 946910351 2:224454628-224454650 CACTTTGCAAAGCTCTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946910351 Original CRISPR CACTTTGCAAAGCTCTGGCT GGG Intergenic
No off target data available for this crispr