ID: 946910730

View in Genome Browser
Species Human (GRCh38)
Location 2:224457910-224457932
Sequence TCTAAGCTTAACTTGGTTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946910730_946910734 26 Left 946910730 2:224457910-224457932 CCGTAAACCAAGTTAAGCTTAGA No data
Right 946910734 2:224457959-224457981 AAATTGGCATAAAACTAAATTGG No data
946910730_946910732 10 Left 946910730 2:224457910-224457932 CCGTAAACCAAGTTAAGCTTAGA No data
Right 946910732 2:224457943-224457965 ATTGTTGTTTTAAGCCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946910730 Original CRISPR TCTAAGCTTAACTTGGTTTA CGG (reversed) Intergenic
No off target data available for this crispr