ID: 946910908

View in Genome Browser
Species Human (GRCh38)
Location 2:224459686-224459708
Sequence ACGTGGGCTGTCAGTCTCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946910899_946910908 25 Left 946910899 2:224459638-224459660 CCATCCTCACCTGCAATCGTAGA No data
Right 946910908 2:224459686-224459708 ACGTGGGCTGTCAGTCTCCACGG No data
946910898_946910908 26 Left 946910898 2:224459637-224459659 CCCATCCTCACCTGCAATCGTAG No data
Right 946910908 2:224459686-224459708 ACGTGGGCTGTCAGTCTCCACGG No data
946910900_946910908 21 Left 946910900 2:224459642-224459664 CCTCACCTGCAATCGTAGAGCCT No data
Right 946910908 2:224459686-224459708 ACGTGGGCTGTCAGTCTCCACGG No data
946910897_946910908 27 Left 946910897 2:224459636-224459658 CCCCATCCTCACCTGCAATCGTA No data
Right 946910908 2:224459686-224459708 ACGTGGGCTGTCAGTCTCCACGG No data
946910901_946910908 16 Left 946910901 2:224459647-224459669 CCTGCAATCGTAGAGCCTAATTG No data
Right 946910908 2:224459686-224459708 ACGTGGGCTGTCAGTCTCCACGG No data
946910903_946910908 1 Left 946910903 2:224459662-224459684 CCTAATTGTATCGTATTACTGGG No data
Right 946910908 2:224459686-224459708 ACGTGGGCTGTCAGTCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946910908 Original CRISPR ACGTGGGCTGTCAGTCTCCA CGG Intergenic
No off target data available for this crispr