ID: 946914358

View in Genome Browser
Species Human (GRCh38)
Location 2:224501701-224501723
Sequence ACTCTTAGATGGTGTACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946914358 Original CRISPR ACTCTTAGATGGTGTACTGG GGG Intronic
904810155 1:33158277-33158299 ACTTCCAGATGGTGTACTGCAGG + Exonic
916782676 1:168052811-168052833 CCTCTTACCTGGTGTACTGAGGG + Intronic
1063693693 10:8312300-8312322 AGTCTTACATGGTTAACTGGAGG - Intergenic
1064538319 10:16380564-16380586 ACTTTTGGAGGCTGTACTGGGGG - Intergenic
1069112768 10:64467588-64467610 ATTTTTAAATGGTGTATTGGAGG + Intergenic
1073027036 10:100495524-100495546 TCTCTTAGCTGCTGAACTGGTGG + Exonic
1074539160 10:114350690-114350712 ACTCTTGGATGGTGCTCTGATGG + Intronic
1075547647 10:123367333-123367355 ACACTCAGATGGGGTCCTGGTGG - Intergenic
1083035990 11:59638054-59638076 ACTCTGAGGTGGAGTAGTGGAGG + Exonic
1088364348 11:109023260-109023282 AGTCACAGATGGTGTACTGTGGG - Intergenic
1090251378 11:125254265-125254287 AATCTCAGATGGTGCACTGATGG + Intronic
1090456140 11:126851253-126851275 TCACTTAGATGATGTGCTGGTGG + Intronic
1095568742 12:43657455-43657477 ACCCATATATGTTGTACTGGGGG - Intergenic
1096190639 12:49615974-49615996 ACTCTTATATGGTATATTGCCGG + Intronic
1102017975 12:109661058-109661080 CCTCTTAGATGATTCACTGGAGG - Intergenic
1103100866 12:118174493-118174515 ACTCTTAAATGCTGTTCTGTGGG + Intronic
1103569840 12:121837686-121837708 ACTCTGAGTTGGTATAATGGTGG - Intergenic
1108423702 13:50276729-50276751 ACTCATAGAACCTGTACTGGAGG - Intronic
1119683087 14:76607360-76607382 ACTCTTAGATGGTGTTCAGAAGG + Intergenic
1137923748 16:52519481-52519503 ACTCATAGAAGATGTAGTGGAGG - Intronic
1142489561 17:269525-269547 GCTGTTAGAAGGTGTTCTGGAGG + Intronic
1143603052 17:7961946-7961968 CCTCTTAGATGCTGTTCTTGGGG - Intergenic
1144119798 17:12140799-12140821 GCTCTTAGATGGTGTGGTGGAGG + Intronic
1145115368 17:20205083-20205105 ACTCTTAAAGGGGTTACTGGTGG - Exonic
1165183672 19:33996868-33996890 TCTCTTCAATGTTGTACTGGAGG + Intergenic
1167938912 19:52930682-52930704 GGTCTTATATGGTGTGCTGGTGG - Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925825552 2:7845346-7845368 ACTCTGAGATGGAGTTCTGAGGG - Intergenic
926087382 2:10028835-10028857 ACCCTCGGATGGTATACTGGGGG + Intergenic
945738458 2:213630993-213631015 ACTCTTAGGAGGTGCCCTGGAGG + Intronic
946914358 2:224501701-224501723 ACTCTTAGATGGTGTACTGGGGG + Intronic
948070954 2:235124536-235124558 TCTATTAAATGTTGTACTGGAGG - Intergenic
1171334077 20:24367781-24367803 ACTCTTCCATGGTGTAGTGGGGG - Intergenic
1173629805 20:44503883-44503905 ACTCTTTGATGGTGGAGTAGGGG + Exonic
1181093295 22:20489046-20489068 CCTCTTCGATGTTGTGCTGGTGG - Exonic
1182730776 22:32490212-32490234 ACGCTTATCTGGTGTAGTGGTGG + Intronic
949874994 3:8620719-8620741 ATTTTTAGATGGAGTGCTGGGGG + Intronic
950020300 3:9782599-9782621 TCTCTTAGATATTGTGCTGGGGG - Intronic
955421937 3:58747355-58747377 ACTTTCAGAAGGTGAACTGGAGG - Intronic
956238066 3:67097209-67097231 TCTCTGAGACGGAGTACTGGGGG + Intergenic
960961536 3:123073697-123073719 ATTCCTAGATGGTGTGATGGTGG + Intronic
964066200 3:152582979-152583001 CCTCTTTGATGGTGTGCTGCTGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG + Exonic
987349974 5:17013181-17013203 ACTCATAGATGGTATACTGGAGG - Intergenic
987808182 5:22797416-22797438 ACTATTAGGTGGTATCCTGGTGG + Intronic
989035987 5:37172501-37172523 ACTGTTAGATGGATTACTTGGGG - Intronic
1004911475 6:20289261-20289283 TCTCTTAGATGTTCTACTGGGGG - Intergenic
1007895231 6:45348876-45348898 ACTATGAGATAGTGTAATGGGGG - Intronic
1008185773 6:48388765-48388787 TCTCTTCAATGGTGTACTGCAGG + Intergenic
1011933671 6:92746199-92746221 ACCATTAGATTGTATACTGGAGG - Intergenic
1015778052 6:136834632-136834654 ACTAGGAGATGGTGTAATGGAGG + Intronic
1018270521 6:162072321-162072343 ACTCTTTGAGGGTATATTGGAGG + Intronic
1032883774 7:136116335-136116357 ACGCTTAGATGGGGCAGTGGAGG + Intergenic
1045121080 8:99035358-99035380 ACTCTTAGAAAGTAGACTGGTGG - Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1051983422 9:23052060-23052082 ACTATTTTATGTTGTACTGGAGG + Intergenic
1061640182 9:131947817-131947839 ACTTTTAGATTTTGTACGGGTGG - Intronic
1062509303 9:136896066-136896088 ACTCCTAGAAGGTGGACTGCAGG - Intronic
1062553454 9:137101512-137101534 AATCTTGGATGGTGTTCTGAAGG - Exonic
1186724058 X:12338028-12338050 ACTCTTACATGGTGGAATGGGGG + Intronic
1190102656 X:47534072-47534094 ACTTCTAAATGGTGTACTTGAGG + Intergenic
1195606387 X:106810148-106810170 AATAATAGGTGGTGTACTGGTGG + Intronic