ID: 946919691

View in Genome Browser
Species Human (GRCh38)
Location 2:224566065-224566087
Sequence CTGTAGATGGGGAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 1, 2: 3, 3: 63, 4: 723}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946919691_946919701 0 Left 946919691 2:224566065-224566087 CCCCCCACCTTCCCCATCTACAG 0: 1
1: 1
2: 3
3: 63
4: 723
Right 946919701 2:224566088-224566110 GCTGAATTAAAAACACTTTAAGG 0: 1
1: 0
2: 2
3: 25
4: 281
946919691_946919702 6 Left 946919691 2:224566065-224566087 CCCCCCACCTTCCCCATCTACAG 0: 1
1: 1
2: 3
3: 63
4: 723
Right 946919702 2:224566094-224566116 TTAAAAACACTTTAAGGTCAAGG 0: 1
1: 0
2: 4
3: 42
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946919691 Original CRISPR CTGTAGATGGGGAAGGTGGG GGG (reversed) Intronic
900642307 1:3693628-3693650 CTGCAGATGGGGACGCAGGGGGG + Intronic
901835243 1:11919861-11919883 CTGTAGATGGTGAGTGTTGGCGG - Exonic
902685364 1:18073282-18073304 CAGGCGATGTGGAAGGTGGGCGG + Intergenic
902758656 1:18566578-18566600 ATGTAGATGGTGAAGGTGGGTGG + Intergenic
903240720 1:21980975-21980997 GTGATGATGGGGAAGGAGGGAGG + Intronic
903244460 1:22005598-22005620 GTGATGATGGGGAAGGAGGGAGG + Intronic
903438874 1:23372144-23372166 TTGGAGGTGGAGAAGGTGGGAGG + Intergenic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903971461 1:27121709-27121731 ATGTAGATGGGACAGGTGAGAGG - Intronic
904449021 1:30599144-30599166 CTGCAGATGGGGGCAGTGGGAGG - Intergenic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
906103491 1:43277774-43277796 CTGTAGAGGGTAAAGGTGGGAGG + Intergenic
906134773 1:43490540-43490562 CTTTGGATGGCCAAGGTGGGTGG + Intergenic
906146741 1:43565048-43565070 CTGTTGTGGGGGAAGGTGGTGGG - Intronic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
906940428 1:50250958-50250980 CTTTAGATGGTGAGGGTGGCAGG + Intergenic
906966213 1:50459215-50459237 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
907437737 1:54460159-54460181 CCTTGGATGGGGAAGGAGGGAGG + Intergenic
907558496 1:55366712-55366734 TTGTAGATGGGGACTTTGGGAGG + Intergenic
907774290 1:57498308-57498330 CTGTAGATGTGGAAAGTCTGAGG + Intronic
908177138 1:61566719-61566741 TTGAAGGTGGGGCAGGTGGGAGG - Intergenic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
911036396 1:93553821-93553843 AGGGAGATGGGGCAGGTGGGGGG + Exonic
911165201 1:94718862-94718884 CGGTAGAGCGGGATGGTGGGAGG + Intergenic
911627492 1:100141573-100141595 CTTTGGAAGGGTAAGGTGGGAGG - Intronic
912326422 1:108767622-108767644 CTGCACATGCGCAAGGTGGGCGG + Intronic
912469864 1:109899187-109899209 CTTCAGATTGGGAAGGTTGGGGG - Intergenic
912702739 1:111890253-111890275 CTGAAGATGGAGATGGTGAGAGG + Intronic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
912747672 1:112258893-112258915 AAGCAGATGGGAAAGGTGGGAGG + Intergenic
913078004 1:115357669-115357691 AAGTGGATGGGGAAAGTGGGAGG + Intergenic
913089264 1:115465605-115465627 CTGCTCATGGGGGAGGTGGGAGG + Intergenic
913260005 1:116989268-116989290 GTGGACATGGGGCAGGTGGGTGG - Exonic
915399278 1:155610642-155610664 CTGGAGCTCGGTAAGGTGGGAGG - Intronic
915523282 1:156460950-156460972 TTGGAAACGGGGAAGGTGGGGGG + Intergenic
915545385 1:156594076-156594098 CTGCAGTGAGGGAAGGTGGGTGG + Exonic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
916491956 1:165309716-165309738 AAGTTCATGGGGAAGGTGGGTGG - Intronic
916509299 1:165457087-165457109 CTGCAGATGGGAAAAGGGGGTGG + Intergenic
917198373 1:172490323-172490345 CAGTTGGTGGGGAAGGGGGGTGG + Intergenic
917485689 1:175452592-175452614 CTGTAGCCTGGGAAGTTGGGGGG + Intronic
917726928 1:177837071-177837093 CTGAAGATGGGGAAAGAGGGAGG + Intergenic
918263747 1:182820799-182820821 CTGGAGGTGGGGCTGGTGGGAGG - Intronic
918332767 1:183474908-183474930 ATGTAGGTAGGGAAGCTGGGGGG + Intronic
918339140 1:183552880-183552902 ATGGAGATGGGGCAGGAGGGTGG - Intronic
919553035 1:199015985-199016007 CAGGAGATGGGGATGATGGGGGG - Intergenic
919988801 1:202694586-202694608 CTGTAGTTAGGGATGGTGTGTGG - Intronic
920350866 1:205337071-205337093 CTGGAGATGGGGGTGGGGGGAGG + Exonic
920500358 1:206481424-206481446 CAGTTGATGGGGCAGCTGGGAGG + Intronic
920784450 1:209027429-209027451 TTTTTGAAGGGGAAGGTGGGGGG + Intergenic
920851381 1:209630407-209630429 CTCTAGCTGGGGACAGTGGGAGG + Intronic
920871862 1:209801481-209801503 TAGTAGATGGGAAAGGTGGCTGG - Intronic
921264125 1:213408292-213408314 CTGCTGATGGGCAAGGTTGGTGG + Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
922203392 1:223425996-223426018 CTATGGAGCGGGAAGGTGGGTGG - Intergenic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923047501 1:230366325-230366347 CTGCAGATGGGGCTGGGGGGTGG + Intronic
924041831 1:239991661-239991683 CTGTAGATAGTGAAGGTGCAAGG + Intergenic
924079370 1:240378010-240378032 GTTTAGATGGGGAAGGAGTGGGG - Intronic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1063420273 10:5906918-5906940 CTCCAGGTGGGGAAGGTGGGAGG - Intronic
1063497547 10:6524452-6524474 CGGTAGATGTGGCAGGTGGTAGG - Intronic
1063544008 10:6962310-6962332 CTGTGGTTGGGCAAGGTAGGAGG - Intergenic
1063619050 10:7628082-7628104 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1063944331 10:11162329-11162351 CTTTTGATCAGGAAGGTGGGGGG + Intronic
1065939311 10:30549736-30549758 CTTTGGATGGCGGAGGTGGGCGG - Intergenic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1066214748 10:33275323-33275345 CTTTAGAAGGCGGAGGTGGGTGG + Intronic
1066265759 10:33774385-33774407 CTGCAGATGGGGAAGCCGGAAGG - Intergenic
1066271873 10:33831926-33831948 CAGTAGAAGGGTAGGGTGGGAGG + Intergenic
1066336333 10:34481978-34482000 CTGTAGCTGAGCATGGTGGGGGG - Intronic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067282138 10:44880742-44880764 CTGTTGATGGGGGAGATGGTGGG + Intergenic
1067565261 10:47331600-47331622 CTGCAGATGAGGAAGGGAGGTGG + Intergenic
1067829840 10:49605241-49605263 ATGAAGATGGGAAGGGTGGGAGG + Intergenic
1067950054 10:50726915-50726937 TTTTAGATTGGGAGGGTGGGGGG - Intergenic
1067985186 10:51135959-51135981 CTGTTGTGGGGGAAGGGGGGAGG + Intronic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1068992542 10:63164663-63164685 CTCTGGATGGCCAAGGTGGGCGG + Intergenic
1069242100 10:66155543-66155565 CTGTAGATCAGGAACGTGTGTGG - Intronic
1069802106 10:71088165-71088187 CTGTAGAGGGGAAAGGATGGAGG + Intergenic
1069974559 10:72202221-72202243 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1070289767 10:75106573-75106595 CAGAGGATCGGGAAGGTGGGGGG - Intronic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1070885383 10:79892121-79892143 CTTTAGATTGGGAAGGTGGGGGG - Intergenic
1071396933 10:85233296-85233318 CTGTGGATGGGGGTGGTGAGCGG + Intergenic
1071677876 10:87673401-87673423 CTTTAGGAGGGCAAGGTGGGAGG - Intronic
1071752205 10:88492660-88492682 CTCTAGAAGGCCAAGGTGGGTGG - Intronic
1071754950 10:88527240-88527262 CTGGGGATGGGGAAGGTTGCTGG - Intronic
1071954480 10:90743172-90743194 CTTTAGATGGGGTGGGTAGGTGG - Intronic
1072638063 10:97190013-97190035 CTGGAGATGAGGAAGGCAGGTGG - Intronic
1073003420 10:100302451-100302473 CTGTGGGTGGTGGAGGTGGGCGG + Intronic
1073218073 10:101847629-101847651 GGGTAGTTGGGGAAGGTGGGAGG + Intronic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074816002 10:117140883-117140905 AGGTAGATGGGGGAGCTGGGGGG + Intergenic
1074843862 10:117379606-117379628 TTCTTGCTGGGGAAGGTGGGAGG + Intergenic
1075240600 10:120775059-120775081 CTGTAGATGGGGAAACTGCCAGG + Intergenic
1075617697 10:123903546-123903568 CTGGAGATGGCAAAGGTGGCGGG - Intronic
1075648178 10:124110019-124110041 CTGCAGATGGTGGAGGTGGGTGG - Intergenic
1075952876 10:126497190-126497212 CTGCTGATGGGAAAGGTGGCAGG + Intronic
1076067932 10:127463851-127463873 CTGGAGCTGGGGAAGCTGAGTGG + Intergenic
1076265609 10:129107630-129107652 ATGCAGATGGGGAAGGGGTGGGG + Intergenic
1077107278 11:847716-847738 TTGTAGATGGGAAAGGGGGTGGG + Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077279772 11:1738054-1738076 CTAATGATCGGGAAGGTGGGTGG + Intronic
1077282654 11:1752691-1752713 CTTGGGATGGGGAAGGAGGGTGG - Intronic
1077318642 11:1930170-1930192 CTGCAGACGAGGAAGGAGGGAGG + Intronic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077820805 11:5738323-5738345 CTGTAGCTGTAGCAGGTGGGTGG - Intronic
1078183873 11:9034735-9034757 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
1078997954 11:16723323-16723345 TTGCGGAGGGGGAAGGTGGGAGG + Intronic
1079049846 11:17144649-17144671 CTTTAGATGGCCAAGGTGGGAGG + Intronic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1080323138 11:31038068-31038090 CTGTTGTTGGGGGAGGGGGGAGG + Intronic
1080779803 11:35419590-35419612 CTGGAGATGGGGGCGGGGGGCGG - Intronic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG + Intronic
1082224512 11:49688412-49688434 CTGTAGGAGGCCAAGGTGGGTGG + Intergenic
1082737946 11:56877119-56877141 CTGTTGCTGGGGATGGAGGGTGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082783523 11:57304049-57304071 CTGTAGATGTGGTGGGTGCGAGG - Intronic
1083068660 11:59952630-59952652 CAGAAGAGGGGGAAGTTGGGAGG + Intergenic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083411749 11:62498513-62498535 CTTTAGAAGGCCAAGGTGGGAGG + Intronic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083802985 11:65057537-65057559 GTGTGGGTGGGGAAGGGGGGTGG + Intronic
1084602024 11:70151524-70151546 CTGTGGCTGGGGAAAGTTGGCGG + Intronic
1084751692 11:71208307-71208329 GGGGAGATGGGGAAGTTGGGGGG + Intronic
1085014606 11:73165051-73165073 CTGTAGATAAGGGAGGTGGAGGG - Intergenic
1085105214 11:73836440-73836462 CTTTAGAAGGGTGAGGTGGGAGG - Intronic
1085211532 11:74784454-74784476 CAGTAGAGGGAGAAGGTGTGTGG + Intronic
1085474182 11:76779333-76779355 CTGTAGATGTGGCATGTGGCAGG - Intergenic
1085798775 11:79567911-79567933 TTGAAGATGGGGAAGGTAGGAGG + Intergenic
1085849375 11:80101888-80101910 ATGTTGATGTGTAAGGTGGGAGG - Intergenic
1085924412 11:80998487-80998509 CTTTAGATGGCCAAGGTAGGTGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087407068 11:97743924-97743946 CTTTGGATGGCCAAGGTGGGTGG - Intergenic
1087619944 11:100529266-100529288 CTGCAGCTGGGTGAGGTGGGGGG - Intergenic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1089055578 11:115582232-115582254 CTGGAGGTGGGGAGGCTGGGTGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089357908 11:117867332-117867354 GTGGAGATGGGGAAGGAGAGAGG - Intronic
1089827583 11:121292811-121292833 CTCCAGGTGGGGACGGTGGGTGG + Exonic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090773002 11:129938380-129938402 ATCAAGATGGGGAAGATGGGTGG - Intronic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091446761 12:548191-548213 GGGTAGATGCAGAAGGTGGGAGG - Intronic
1091614599 12:2039918-2039940 CTGGAGATGGGGATGGGGGTAGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091831599 12:3554253-3554275 CTGTCCATGGGAAAGGTGAGAGG - Intronic
1091845767 12:3655314-3655336 CTGTGGATGGGGAAATGGGGAGG + Intronic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092676752 12:10929393-10929415 CTATAGAGGGGGAAAGTGGAGGG + Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1092986863 12:13854266-13854288 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
1093015491 12:14150707-14150729 CTGGAGATGGGGTTGGGGGGGGG - Intergenic
1093089104 12:14901788-14901810 CTGTAGATGGGAAATGTGGCAGG + Intronic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1095722753 12:45418368-45418390 CAGTAGATGTTGAAGGTGTGGGG - Intronic
1095797047 12:46231288-46231310 CCAAAGAAGGGGAAGGTGGGAGG + Intronic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097222934 12:57461237-57461259 CAGTAGAGGGAGAAGGCGGGCGG + Intronic
1097231165 12:57512124-57512146 CTGTGCATGGGGAGGGTAGGCGG + Intronic
1097539119 12:60914109-60914131 CTGAAGGTGGGGCAGGTGTGGGG - Intergenic
1099382866 12:81976530-81976552 CTGTAGACAGGGAAGATGTGGGG - Intergenic
1100332563 12:93598325-93598347 GGGTAGAAGGTGAAGGTGGGAGG + Intergenic
1100361453 12:93883572-93883594 CTTTAGAAGGCCAAGGTGGGAGG + Intronic
1100825138 12:98467958-98467980 CTTTAGAAGGCGGAGGTGGGAGG - Intergenic
1101417223 12:104518774-104518796 CTTTAGCTGGGGATGTTGGGAGG + Intronic
1101530953 12:105573349-105573371 CTGAAGATGGGGACTTTGGGAGG - Intergenic
1101674597 12:106906536-106906558 GTGTGGTTGGGGATGGTGGGTGG - Intergenic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1102287500 12:111670731-111670753 CTTTAGAAGGCCAAGGTGGGCGG - Intronic
1102466360 12:113133033-113133055 CTGTAGTTGGGGAAACTGAGGGG - Intronic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102679297 12:114679862-114679884 CCTTAGATGGTGAGGGTGGGGGG - Intronic
1103191656 12:119006832-119006854 CTGGAGATGGGCATGGTGGTGGG + Intronic
1103502133 12:121411169-121411191 CTTTAGGTGGCCAAGGTGGGAGG - Intronic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1104009830 12:124922206-124922228 CTGCAGGTAGTGAAGGTGGGGGG - Intergenic
1104632685 12:130417569-130417591 CACTAGATGGTGAAGGAGGGAGG + Intronic
1105500533 13:20967720-20967742 CAGGAGTTGGGGTAGGTGGGAGG - Intergenic
1105635364 13:22210796-22210818 CTGAAGATGGTGCAGGTTGGGGG - Intergenic
1106095953 13:26644049-26644071 CTTTAAATGGGAAAGGAGGGAGG + Intronic
1106155313 13:27149615-27149637 CTGCAGATGTGGGGGGTGGGAGG + Intronic
1106386858 13:29295425-29295447 CTAGAGGTGGGGAAGGTAGGGGG - Intronic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1107384631 13:39894577-39894599 CTGCAGGTGAGAAAGGTGGGGGG + Intergenic
1107927200 13:45274570-45274592 CTTTAGGTGGTCAAGGTGGGCGG - Intronic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1108615312 13:52127125-52127147 CTTTGGATGGCCAAGGTGGGAGG - Intronic
1108689933 13:52850883-52850905 CGGAAGGTGGGGAAAGTGGGTGG + Intergenic
1109289427 13:60455822-60455844 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1109632243 13:65065427-65065449 CTGTAGATGAACAAGTTGGGTGG - Intergenic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1110448120 13:75610854-75610876 CTGTAGTGGTGGAAGATGGGAGG - Intergenic
1111940845 13:94604816-94604838 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1112643552 13:101304679-101304701 CTTTAGGTGGCCAAGGTGGGTGG - Intronic
1112809286 13:103199099-103199121 CTGTAGATGGGCAAGCGGGAGGG + Intergenic
1112907254 13:104439171-104439193 CTGTTGTGGGGGAAGGGGGGAGG + Intergenic
1113483938 13:110641154-110641176 CTGGGGATGGGTGAGGTGGGTGG - Intergenic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1113976401 13:114231074-114231096 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976435 13:114231188-114231210 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976469 13:114231302-114231324 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976487 13:114231359-114231381 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976521 13:114231473-114231495 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1114501478 14:23172334-23172356 TTGTAGATGCCGCAGGTGGGCGG + Intronic
1114502565 14:23181956-23181978 CTGAAGGTGGGGAACCTGGGTGG - Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1116422719 14:44751762-44751784 TTGGAGATGGGGCTGGTGGGAGG + Intergenic
1116616509 14:47147502-47147524 CTGTTGATAGGGGAGGTGGTCGG - Intronic
1116848003 14:49882517-49882539 TTGTAGATGCGGAGGGTGGGAGG + Intergenic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117785510 14:59280494-59280516 GAGAAGATGGGGAAGCTGGGAGG - Intronic
1117978215 14:61319151-61319173 CTGGAGCTGAGGAAGGTGAGGGG - Intronic
1118122564 14:62861619-62861641 GTGTAAATGGAGATGGTGGGGGG - Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1119458927 14:74781816-74781838 CAGAAGACAGGGAAGGTGGGGGG - Exonic
1119831079 14:77703224-77703246 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121001896 14:90456930-90456952 CCGGGGATGGGGAAGGAGGGAGG + Intergenic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122770896 14:104097199-104097221 CTGTAGAGGGAGCTGGTGGGTGG + Intronic
1122855760 14:104559424-104559446 CTGGAGATGGGGATGGAGGGAGG - Intronic
1122971764 14:105155087-105155109 TTGTAGCTGGGCAAGGTGGGTGG - Intronic
1123959623 15:25383391-25383413 CTTTAGAAGGGCAAGGTGGGTGG + Intronic
1124106167 15:26740137-26740159 GTGAGGATGGGGATGGTGGGGGG - Intronic
1124410098 15:29429931-29429953 GTATAGATGGGGTATGTGGGTGG - Intronic
1124805253 15:32875311-32875333 CTGTAGATGGTGAAAGTAGGAGG - Intronic
1125349058 15:38748625-38748647 CCATAGATGTGGATGGTGGGGGG - Intergenic
1125363306 15:38887519-38887541 CTGTAGATGACCAAGGTTGGGGG + Intergenic
1125792644 15:42380714-42380736 ATATATATGGGGAAGGTGGGGGG - Intronic
1127288356 15:57549487-57549509 CTGTAGATGTGGAAGGGGCTTGG - Exonic
1128080776 15:64855570-64855592 CTGTAGCTGGGGAAGGTCCCTGG + Intronic
1128391259 15:67184348-67184370 CTTTAGGAGGGCAAGGTGGGAGG - Intronic
1129688245 15:77698495-77698517 GTGTAGTTGGGGAAGGGGCGGGG + Intronic
1129697578 15:77749377-77749399 CTGGAGATGGGGCTGGTGGGAGG - Intronic
1129797536 15:78389466-78389488 CTCCAGCTGGGGAAGGAGGGAGG + Intergenic
1129843682 15:78758572-78758594 CTGTAGCTGGGGCTGGTGGTGGG + Intergenic
1129869023 15:78929115-78929137 AGGAAGATGGGGCAGGTGGGGGG + Intronic
1130475412 15:84261983-84262005 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1130482829 15:84376037-84376059 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130551267 15:84891239-84891261 ATGAAGCTGTGGAAGGTGGGCGG + Intronic
1131074108 15:89484072-89484094 TTGTTGATGGGGTGGGTGGGGGG + Intronic
1131593571 15:93773989-93774011 GTGTGGATGGGGGAGGAGGGGGG - Intergenic
1132646641 16:1002268-1002290 CTGGAGATGTGGCAGGAGGGAGG + Intergenic
1132983403 16:2751058-2751080 CAGGAGATGGGGGTGGTGGGGGG + Intergenic
1133044001 16:3076069-3076091 CAGCAGATGGGGGAGATGGGCGG + Intronic
1133420216 16:5639696-5639718 CTGTAGGTGGCTGAGGTGGGAGG + Intergenic
1133445207 16:5853684-5853706 CTGTAGACGAGGGAGGTGTGGGG + Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1134255788 16:12610248-12610270 TTGGAGATGGGGAATGTGCGTGG - Intergenic
1134291290 16:12904109-12904131 CTGTGGTTGCGGAAGGTGGGCGG - Intronic
1134425621 16:14141107-14141129 CCGGAGATGGAGAAAGTGGGAGG - Intronic
1134539019 16:15049270-15049292 CTGTAGGAGGCCAAGGTGGGTGG - Intronic
1134608906 16:15592482-15592504 CTGCAGTGGGGGCAGGTGGGTGG + Intronic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1135330645 16:21557133-21557155 CTGTAAATGGGGAAGGCTGAGGG + Intergenic
1135845814 16:25917452-25917474 CTTTAGATGGCTGAGGTGGGTGG - Intronic
1136040700 16:27576530-27576552 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1138053622 16:53809696-53809718 CTGTAGGAGGCCAAGGTGGGAGG + Intronic
1138453224 16:57106104-57106126 CTGGAGTTGGGGCAGGCGGGGGG - Intronic
1138537737 16:57668652-57668674 CTGGAGATAGGGGAGGTCGGAGG + Intronic
1138542761 16:57698441-57698463 CTTTAGAAGGAAAAGGTGGGAGG + Intronic
1139046224 16:63062793-63062815 CTGTAGAGGGTGAAGGTATGGGG + Intergenic
1139130732 16:64141243-64141265 CTGGAGATTGGGAAGTTTGGAGG + Intergenic
1139532818 16:67551423-67551445 CTTTAGAAGGCCAAGGTGGGAGG - Intergenic
1140027432 16:71303439-71303461 CTGTGGCTGGGGGCGGTGGGGGG - Intergenic
1140031342 16:71341555-71341577 CTCTGGATGGGGATGGAGGGGGG + Intergenic
1140546996 16:75820327-75820349 CTGCAGATGGGCATGGTGGAAGG + Intergenic
1141603153 16:85138235-85138257 CTAAAGATGGGGTTGGTGGGGGG + Intergenic
1141856484 16:86684760-86684782 CTGGAGACGGGGAGAGTGGGGGG - Intergenic
1142175721 16:88644023-88644045 CTGCACATGGGGGTGGTGGGGGG + Intronic
1142494570 17:299498-299520 CTGCTGATGGGGAAGCTGAGTGG - Intronic
1142669378 17:1480698-1480720 CTGTACCTGGTGAAGGTGAGTGG - Exonic
1142728161 17:1831477-1831499 CTGTGGATGGGAATGGTGGCAGG - Intronic
1143113598 17:4568068-4568090 CTTTAGAAGGCCAAGGTGGGCGG - Intergenic
1143637972 17:8177199-8177221 CTGTAGCTGGGCAATGTCGGAGG - Intergenic
1143747293 17:9003646-9003668 CTGGAGATGGGGAAAGCGAGGGG - Intergenic
1145094281 17:20010460-20010482 TTGAAGATGGGGGAGGAGGGAGG + Intronic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1146454548 17:32998704-32998726 CTCTAAAGGAGGAAGGTGGGTGG + Intergenic
1146845933 17:36182215-36182237 TGGTAGATGGGGAAGGAGAGAGG + Intronic
1147020345 17:37526759-37526781 CCTTAGAAGGGGAAGGTAGGAGG - Intronic
1147473764 17:40689789-40689811 GTGGAGTGGGGGAAGGTGGGAGG - Intergenic
1147605914 17:41773626-41773648 CTGTTGCTGGGGAAGGGGTGTGG - Intronic
1147657562 17:42099220-42099242 CTGGAGATGGGACAGGAGGGAGG + Intergenic
1147921442 17:43919536-43919558 CTAGAGATGGTGAAGGTTGGGGG - Intergenic
1147966337 17:44196230-44196252 GTGTGGGTGGGGAAGGGGGGTGG - Intronic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1148234021 17:45955498-45955520 CTGTAGGTGGGTGAGGTGGCTGG - Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148482174 17:47967174-47967196 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148860530 17:50602163-50602185 CTGGAGATGGAGAAGCTGAGTGG - Intronic
1149802225 17:59580548-59580570 CTTTGGATGGCCAAGGTGGGAGG + Intronic
1149844265 17:59994941-59994963 CTTTGGATGGCCAAGGTGGGAGG - Intergenic
1149849134 17:60025145-60025167 TGGTAGATGGGGAAGGAGAGAGG + Intergenic
1149861034 17:60121379-60121401 TGGTAGATGGGGAAGGAGAGAGG - Intergenic
1150125669 17:62632913-62632935 CTGTAGATGAGGCAGGAGTGTGG + Intronic
1150675525 17:67244199-67244221 CTGGAGCGGGGGAAGGAGGGAGG - Intronic
1150895752 17:69208791-69208813 CTTTAGGTGGCCAAGGTGGGAGG + Intronic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151669631 17:75564986-75565008 CTCTAGCTGGGGAGGGTGGCAGG - Intronic
1151727757 17:75894490-75894512 AGGGAGATGGGGAAGGTCGGGGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152235586 17:79136640-79136662 CAGAAGATGGGGAAGGTGCTGGG + Intronic
1152256751 17:79244479-79244501 CTGAAGGTGGGGAGGGTGGGTGG - Intronic
1152407297 17:80104974-80104996 TTGTAGCTGGGGTAGCTGGGTGG - Intergenic
1152496652 17:80677569-80677591 CTGGTGAGAGGGAAGGTGGGAGG - Intronic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1155234278 18:23803878-23803900 CTGTAGATGTGGAATGTAGCAGG + Intronic
1155335760 18:24763937-24763959 CTGTACATGAGCCAGGTGGGTGG - Intergenic
1157436337 18:47672631-47672653 ATGGAGATGGGGACGGGGGGCGG + Intergenic
1157550267 18:48576357-48576379 CGGTAGCTGGGGAAGGGAGGCGG + Intronic
1157648481 18:49302595-49302617 CTGTTGAAGGCGGAGGTGGGGGG + Intronic
1159580420 18:70229498-70229520 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
1160288813 18:77571726-77571748 CTTGAGATGGGGAAGGTGAGTGG + Intergenic
1160665328 19:325487-325509 CTGTGGCTGGAGGAGGTGGGAGG - Intronic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1160815460 19:1033735-1033757 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815478 19:1033805-1033827 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815513 19:1033945-1033967 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815530 19:1034015-1034037 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815635 19:1034437-1034459 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815669 19:1034577-1034599 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815686 19:1034647-1034669 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815800 19:1035103-1035125 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815809 19:1035139-1035161 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815818 19:1035173-1035195 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1161202313 19:3022347-3022369 TTGTAGATGGGGTGGGGGGGTGG - Intronic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161473380 19:4472434-4472456 CGGGAGATGGGGCCGGTGGGGGG + Intronic
1161513319 19:4683416-4683438 GCGTAGATGGGGAAGGGGGCAGG + Intronic
1161762342 19:6183317-6183339 GTCAAGAGGGGGAAGGTGGGTGG + Intronic
1161845452 19:6709613-6709635 CTGGGGCTGGGGGAGGTGGGTGG - Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1162086179 19:8250696-8250718 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1162205900 19:9055801-9055823 CTGGGGATGGGGAAGCCGGGAGG - Intergenic
1162230795 19:9264366-9264388 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1163034731 19:14564096-14564118 CAGTAAGTGGGGCAGGTGGGAGG + Exonic
1163115220 19:15185080-15185102 CTGGGGTTGGGGGAGGTGGGGGG - Intronic
1163147657 19:15392075-15392097 CTTTAGGAGGTGAAGGTGGGAGG - Intronic
1163227396 19:15974025-15974047 CTTTAGGTGGCCAAGGTGGGTGG + Intergenic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163420226 19:17210052-17210074 CTCTAGGTGGGGCAGGTAGGGGG + Intronic
1163651451 19:18520714-18520736 CTGTTGATGGTGGGGGTGGGGGG - Intronic
1163690818 19:18737242-18737264 CTATAGAGGGGTCAGGTGGGGGG + Intronic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1163754689 19:19099652-19099674 CTGGAGATGGGGAAGGGATGTGG - Intronic
1165246336 19:34500470-34500492 CTGGTGATGGGGTGGGTGGGAGG - Exonic
1165404532 19:35621701-35621723 CTGAAGCTGGTGAGGGTGGGGGG - Intronic
1165742215 19:38211133-38211155 CTGCAGGTGGGGGAGGTGGTGGG - Intronic
1166044799 19:40223547-40223569 CTGCAGATGGGGGATGCGGGGGG + Intronic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166338542 19:42123122-42123144 ATGTGGATGGGGAAAGTGGTGGG - Intronic
1166750894 19:45163527-45163549 CTGAAGGTGGGGGAGGTGGTGGG + Intronic
1166754961 19:45184974-45184996 ACCTAGATGGGGAAGATGGGAGG + Intronic
1166971612 19:46572312-46572334 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167085988 19:47310039-47310061 CAGGAGAGAGGGAAGGTGGGAGG - Intronic
1167245942 19:48373269-48373291 CTGGAGGTGGGGAGGCTGGGAGG + Intronic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167470441 19:49672720-49672742 CCCGAGATGGGGAAGGTGTGGGG + Intronic
1167499649 19:49837881-49837903 CTGTGGATGGGGAAGACGGTGGG + Intronic
1167568563 19:50272411-50272433 AGATAGATGGGGAAGGTGGGAGG + Intronic
1168108507 19:54179112-54179134 CTGTAGGGTAGGAAGGTGGGTGG + Intronic
1168247340 19:55119022-55119044 CTCAAGATTGGGAAGGTGGCTGG + Intergenic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
1168678832 19:58299049-58299071 CTTTGGATGGCCAAGGTGGGAGG - Exonic
924999312 2:392429-392451 CTGTGGCTGGTGGAGGTGGGAGG + Intergenic
925587044 2:5474854-5474876 GTGTGGGTGGGGCAGGTGGGTGG - Intergenic
925657892 2:6168940-6168962 CTGGAGAGAGGGAAGGAGGGAGG - Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
926722476 2:15971460-15971482 CTGCAGAGGGGGCTGGTGGGGGG + Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928512232 2:32012188-32012210 CTGAAGTTGGAGAAGGTGGGAGG - Intronic
928629754 2:33178982-33179004 CTGTAGGAGGCCAAGGTGGGAGG - Intronic
929536583 2:42787933-42787955 TTGTGGCTGGGGCAGGTGGGAGG - Intronic
930760408 2:55029013-55029035 CTGAAGATGGGGACTTTGGGAGG + Intronic
931561782 2:63569744-63569766 ATGTAGGTGGGGAATTTGGGGGG - Intronic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932586770 2:73035231-73035253 GTGTGGATGGAGGAGGTGGGTGG - Intronic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933425679 2:82109490-82109512 CTTTAGAAGGCCAAGGTGGGGGG - Intergenic
934308568 2:91844382-91844404 CTGTAGAAAGAGAAGGTGAGGGG - Intergenic
934551743 2:95267093-95267115 CGGTGGACGTGGAAGGTGGGGGG + Intergenic
934592002 2:95561993-95562015 CAGTAGAGAGGGAAGGTGGCTGG - Intergenic
934906928 2:98213332-98213354 ATGCAGATGGGTAGGGTGGGCGG - Intronic
935282124 2:101527323-101527345 CTGTACTTGGGGAATGTGGTGGG + Intergenic
935306397 2:101741132-101741154 CTGTACATGGGGAAGTGTGGAGG + Intronic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
935881833 2:107573147-107573169 TAGTAGACGGGGAAGGTGGGGGG + Intergenic
936328264 2:111524044-111524066 CTGGAGATGGGGCAGGTTGGGGG + Intergenic
936464294 2:112733425-112733447 CTTTAGATGGGGTGGGAGGGGGG + Intronic
937208033 2:120249274-120249296 CTTTAGGAGGTGAAGGTGGGTGG - Intronic
937991289 2:127663838-127663860 CTCTGGATGGGGAGGTTGGGAGG - Intronic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
939153868 2:138501930-138501952 CGGGAGATAGGGAAGGAGGGCGG + Exonic
939855144 2:147349786-147349808 CTGTAGGAGGCCAAGGTGGGTGG + Intergenic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
940449853 2:153823587-153823609 ATGTATATGGTGAAGGTTGGGGG - Intergenic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
942063745 2:172251184-172251206 TTATAGATGGGAAAGGTGTGTGG + Intergenic
942135255 2:172919028-172919050 CTGCAGAGGAGGAGGGTGGGAGG + Intronic
942858863 2:180585761-180585783 CTGGGGTTGGGGAAGGGGGGAGG - Intergenic
943629044 2:190230260-190230282 AAGTAAATGGGGATGGTGGGTGG + Intronic
943907588 2:193519115-193519137 CTTTAGGAGGGCAAGGTGGGAGG - Intergenic
945094062 2:206202685-206202707 GTGGGGATGGGGGAGGTGGGTGG + Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945955908 2:216085546-216085568 GTGGAGATGGGAAAGTTGGGTGG + Intronic
946080349 2:217113227-217113249 CTGTTCCTGGGAAAGGTGGGTGG + Intergenic
946203185 2:218083504-218083526 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
946979917 2:225199275-225199297 CTGTAGATGGTCAAGGAAGGAGG - Intergenic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948758271 2:240172189-240172211 CTGGAGATGGGGCAGGGGTGGGG - Intergenic
948765689 2:240217589-240217611 GTGGAGCTGGTGAAGGTGGGTGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948934166 2:241151368-241151390 GTGGAGCTGGGGAAGGAGGGCGG + Intronic
949036046 2:241816176-241816198 CTGTAGAAGGCGAAGGAGTGAGG - Exonic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1171035102 20:21707658-21707680 AGGAAGATGGGGAAGGCGGGAGG + Intronic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171350000 20:24494787-24494809 CAGTACATGGGGAAGGCTGGAGG - Intronic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172414420 20:34752683-34752705 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1172642948 20:36452421-36452443 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
1172656689 20:36542148-36542170 CTGTGGGTGGGGAAGGTCTGCGG + Intronic
1172881720 20:38204433-38204455 CTGGGGATAGGGGAGGTGGGAGG - Intergenic
1172897671 20:38311991-38312013 CCGTAGAAGGGGGAGGTGTGTGG - Intronic
1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG + Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173613530 20:44388195-44388217 CTTTAGGTGGCCAAGGTGGGAGG - Intronic
1174149093 20:48473554-48473576 CTGTAGATGGGGACCTCGGGAGG - Intergenic
1174414858 20:50359950-50359972 GTGTAGATGTGGAAGGTGAGAGG + Intergenic
1174822077 20:53735201-53735223 CTTTAGAAGGCCAAGGTGGGAGG + Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175417863 20:58813331-58813353 AGGAAGGTGGGGAAGGTGGGTGG - Intergenic
1178922052 21:36745148-36745170 CTGCTCGTGGGGAAGGTGGGAGG + Intronic
1179016002 21:37594960-37594982 CTTCAGATGGGGAGGGCGGGGGG - Intergenic
1179242940 21:39608121-39608143 GTGTAGATGGGGAAACTGAGGGG + Intronic
1179371324 21:40808716-40808738 CTTTAGGAGGGCAAGGTGGGAGG - Intronic
1179799089 21:43802580-43802602 CTGCAGACAAGGAAGGTGGGTGG - Intronic
1179835956 21:44033615-44033637 CTGTAGGAGGGTCAGGTGGGAGG + Intronic
1179880844 21:44292773-44292795 GTGTAGACGGGGGAGGAGGGAGG + Intronic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1181171032 22:21010202-21010224 ATGTACATGAGGGAGGTGGGTGG - Intronic
1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG + Intergenic
1181479881 22:23192021-23192043 CTATAGATGTGGATGGTGGCTGG + Intronic
1181662859 22:24365975-24365997 TTGTAGACAGGGAGGGTGGGGGG + Intronic
1182132529 22:27867239-27867261 CAGGAGATGGAGGAGGTGGGGGG + Intronic
1182399346 22:30062634-30062656 CAGTAGTTGGGGGCGGTGGGCGG + Intergenic
1182443276 22:30376363-30376385 CTGGAGGTGGGGCAGGTGAGTGG + Intronic
1182560812 22:31157596-31157618 CTGTAGAAGCCCAAGGTGGGAGG + Intergenic
1182657678 22:31903357-31903379 GTTTAGGTGTGGAAGGTGGGGGG - Intronic
1182657687 22:31903380-31903402 ATTTAGGTGTGGAAGGTGGGGGG - Intronic
1182657710 22:31903448-31903470 GTTTAGGTGTGGAAGGTGGGGGG - Intronic
1182657749 22:31903565-31903587 GTTTAGGTGTGGAAGGTGGGGGG - Intronic
1182657768 22:31903630-31903652 CTTTAGGTGTGGAAGGTGGGGGG - Intronic
1182657776 22:31903653-31903675 GTTTAGTTGTGGAAGGTGGGGGG - Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183063264 22:35348080-35348102 CTGTAGATGGTGCAGGCGGAAGG + Intergenic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1184047231 22:41979001-41979023 CTGTACTTGGGGCTGGTGGGTGG + Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184582512 22:45426998-45427020 CCAGAGATGGGGAAGGTGGTGGG + Intronic
1184894790 22:47400608-47400630 CTGTAAATTGGGAGTGTGGGTGG - Intergenic
1185151177 22:49164729-49164751 CTGTAGGTGGGGGCCGTGGGTGG - Intergenic
1185151212 22:49164815-49164837 CTGTAGGTGGGGGCCGTGGGTGG - Intergenic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
949980447 3:9499315-9499337 GTGTGGATGGGGCAGGTGGCAGG - Exonic
950520115 3:13493160-13493182 CTGTGGGTGGGGCAGGTGGGGGG - Intronic
951186558 3:19720669-19720691 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
951500539 3:23381895-23381917 ATGTAGACTGAGAAGGTGGGAGG + Intronic
952543341 3:34391730-34391752 CTCCAAATGGGGAATGTGGGAGG + Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953830894 3:46296938-46296960 CTGTATGTGGGGATGGCGGGTGG - Intergenic
954042403 3:47898701-47898723 CTTTAGAAGGGTTAGGTGGGAGG + Intronic
954057136 3:48036283-48036305 CTGTGGGTGGAAAAGGTGGGAGG - Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954246920 3:49339653-49339675 GTGGAGAAGGGGAAGGTTGGTGG - Intronic
954451084 3:50572092-50572114 CTGCAGAGGGGGCAGCTGGGTGG - Intronic
954628815 3:52037325-52037347 CTGTAGCTGGGGCAGGTGTCAGG - Intergenic
954707135 3:52487123-52487145 CTCCAGATGTGGCAGGTGGGAGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955308178 3:57855631-57855653 CTTTGGATGGCTAAGGTGGGAGG + Intronic
955972116 3:64445789-64445811 CTGTAGCTGGGGTAGGGGAGTGG + Intergenic
956905035 3:73756900-73756922 ATCAAGATGGGGAAGATGGGTGG + Intergenic
957086048 3:75678142-75678164 CTTGAGGGGGGGAAGGTGGGAGG - Intergenic
957094727 3:75768174-75768196 CTTTAGATGGGGTTGGTGGAAGG - Intronic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
959360836 3:105389733-105389755 CTGTTGAGGGGGTAGGGGGGAGG - Intronic
960404015 3:117238002-117238024 CTGCTGATGGGGAATGTGGGAGG - Intergenic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
960734621 3:120765024-120765046 TTGGGGATGGGGAGGGTGGGGGG - Intronic
960991220 3:123312951-123312973 CTGAACATGGGGCAGGAGGGAGG + Intronic
961028643 3:123583811-123583833 GGGTAGAAGGGAAAGGTGGGAGG + Intronic
961243292 3:125430724-125430746 CTGTAGACTGGCAAGGTTGGGGG - Intergenic
961650765 3:128415702-128415724 CTCTTGATGGGCAGGGTGGGAGG + Intergenic
961780904 3:129319543-129319565 CTGTAGGTGGGGAAGGTCCCAGG + Intergenic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
962373627 3:134841398-134841420 CTGTATGTGGGACAGGTGGGAGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
962974350 3:140433227-140433249 TTGTGGATGGTGGAGGTGGGAGG + Intronic
963543372 3:146623848-146623870 CGGGAGATTGGGAAGGTGGGAGG - Intergenic
964288904 3:155153268-155153290 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
964572936 3:158130251-158130273 CTGAAGATGGGTCTGGTGGGAGG - Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
964862501 3:161218273-161218295 CTTTGGATGGCCAAGGTGGGAGG - Intronic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
966635591 3:182129792-182129814 ATGTAAATGGGGAAGGAGCGGGG + Intergenic
966678365 3:182613737-182613759 CTTTGGCTGGGGTAGGTGGGAGG - Intergenic
967126347 3:186427868-186427890 CTGCAGCTGGGGAAGGGGGCAGG + Intergenic
967913452 3:194560434-194560456 CTGGAGAATGGGCAGGTGGGTGG - Intergenic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968812205 4:2805156-2805178 CTCTAGATGAGGAAGGTGCCCGG + Intronic
969167478 4:5329498-5329520 CTCTAGCAGGTGAAGGTGGGTGG - Intronic
969308868 4:6340594-6340616 GTGCAGGTGGGGAAGGTGGTGGG - Intronic
969313933 4:6370382-6370404 CTGCAAATGGGGAGGGTGTGGGG - Intronic
969470862 4:7388546-7388568 CTGTGGGTGGGGAAGCGGGGAGG - Intronic
970251977 4:14126324-14126346 CTGTACATGGGGACTGTGTGGGG - Intergenic
970530027 4:16971991-16972013 CGATAAATGGGGAAAGTGGGGGG + Intergenic
971248629 4:24952833-24952855 CAGGGGATGGGGAAGATGGGGGG - Intronic
971501805 4:27326294-27326316 CTCAAGAGGGGGAAGGAGGGAGG + Intergenic
971930859 4:33081009-33081031 TTGTAGATGGGGAAGGGATGAGG + Intergenic
972471094 4:39405276-39405298 CTTTAGAAGGCCAAGGTGGGAGG - Intergenic
972639812 4:40915184-40915206 AGGTAGATTGGGAGGGTGGGGGG - Intronic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
973314779 4:48748576-48748598 CTGTAGCTGGGGAAAGGTGGAGG - Intronic
974447909 4:62010304-62010326 GTGTTGAGGGGGAAGGTGTGTGG - Intronic
974873933 4:67679164-67679186 CTTTATATGAGAAAGGTGGGAGG + Intronic
975067483 4:70086045-70086067 CTGAAGTGGGTGAAGGTGGGAGG + Intergenic
975591419 4:76003950-76003972 TTGTAGCTGGGGCAGGTGAGTGG - Intronic
975665164 4:76727908-76727930 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
978738436 4:112110583-112110605 CTCTTGTTGGGGAAGGTGGGAGG + Intergenic
979670506 4:123355985-123356007 CTGCAGGTGGGGATGGTTGGGGG - Intergenic
979942892 4:126784913-126784935 CTGTAGTTGGAGAAGGGAGGAGG - Intergenic
979994804 4:127418034-127418056 CTGAATCTGGGGAATGTGGGAGG - Intergenic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
981669961 4:147275396-147275418 ATGTCGGTGGGGAGGGTGGGTGG - Intergenic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
983595852 4:169466999-169467021 CTGAAGAGGAGGAAGTTGGGGGG - Intronic
984652607 4:182286550-182286572 CTGTAGATGCAGAAGGTTGTGGG + Intronic
984886430 4:184454148-184454170 CTGTGGATGTGGAGTGTGGGAGG - Intronic
985286056 4:188337114-188337136 CAGCAGATGGGAAAGGTGGGCGG - Intergenic
985675589 5:1229854-1229876 CTGGAGATGGGGGAGGGGAGAGG + Intronic
985704314 5:1391698-1391720 GTGACGATGGGGACGGTGGGAGG + Intergenic
985777314 5:1851568-1851590 GAGGAGATGGGGGAGGTGGGAGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986310025 5:6544785-6544807 CTGAGGGTGGGGACGGTGGGGGG - Intergenic
986443803 5:7803653-7803675 CTTTAGGTGGCCAAGGTGGGAGG + Intronic
986609444 5:9551951-9551973 TTGCAGATGGGAAAGCTGGGTGG - Intergenic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
988247873 5:28711809-28711831 CTTTAGAAGGCCAAGGTGGGCGG - Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988722987 5:33897106-33897128 ATTAAGATGGGGAAGATGGGAGG + Intergenic
990141538 5:52710102-52710124 CTTTAAATGGGGATGGTAGGAGG - Intergenic
990662308 5:58029771-58029793 CTGGAGATGGGGAAGCTGTATGG + Intergenic
990670967 5:58129687-58129709 ACTTAGAGGGGGAAGGTGGGAGG + Intergenic
990820498 5:59834285-59834307 CTTTCGATGGGTAAGATGGGAGG - Intronic
990988749 5:61664640-61664662 TTCCAAATGGGGAAGGTGGGTGG + Intronic
991187168 5:63823244-63823266 CTTTGGATGGCCAAGGTGGGAGG + Intergenic
991367808 5:65887179-65887201 CCTTAGAAGGGGAAGGTTGGTGG + Intergenic
992185998 5:74245210-74245232 AAGGAGATGGGGAAGGTAGGGGG - Intergenic
992967648 5:82019699-82019721 CTACAGATGGGGAGGGAGGGAGG + Intronic
993302192 5:86225058-86225080 GTGTTGATGTGGGAGGTGGGGGG - Intergenic
993330547 5:86594696-86594718 CATTATATAGGGAAGGTGGGCGG - Intergenic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
993726381 5:91372077-91372099 CTGAAGATAAAGAAGGTGGGAGG - Intronic
995178067 5:109201439-109201461 CTAGAGATGGGGAAGGGGTGAGG + Intergenic
995439039 5:112169709-112169731 CTAAAGATGGGGACGGAGGGTGG + Intronic
995728696 5:115212375-115212397 TTTTAGATTGGGAGGGTGGGGGG - Exonic
996766500 5:127039598-127039620 CTGGGGATGGGGAAGGATGGAGG + Intergenic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997329393 5:133048167-133048189 TGGTTGTTGGGGAAGGTGGGGGG - Intergenic
997445264 5:133935662-133935684 CTGAAGATGGGGAGGGCGAGGGG - Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
997996807 5:138593095-138593117 CTGAAGATGGGCAGGGTTGGGGG + Intergenic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
1000769973 5:165340722-165340744 CTATAGGTGGAGAAGGTGGCTGG + Intergenic
1001040912 5:168334546-168334568 CTGTAAATGGGGGTGGAGGGGGG - Intronic
1001430744 5:171660040-171660062 CTGCAGCTGGGGATGGGGGGTGG - Intergenic
1001507449 5:172291097-172291119 CTGTAGGAGGCCAAGGTGGGAGG - Intergenic
1001650701 5:173314017-173314039 CTGAAGTAGGGGAAGGTGTGTGG + Intergenic
1002067566 5:176659779-176659801 GGGTAGATGGTGAATGTGGGTGG - Intergenic
1002068539 5:176664895-176664917 CTGCAGCTGGGGTGGGTGGGAGG - Intergenic
1002286621 5:178166554-178166576 CTGCAGTGAGGGAAGGTGGGTGG + Intergenic
1002314984 5:178337627-178337649 CTGTAGAGGGGGCAGGAGGTTGG + Intronic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002591453 5:180293502-180293524 CTGCAGATGGGGAGGGTAAGGGG + Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003132343 6:3405411-3405433 CTGAAGATGGGGAAACCGGGTGG + Intronic
1003523037 6:6874821-6874843 CTGTAGCTGGGAAATCTGGGAGG - Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1003637297 6:7844601-7844623 CTGCGGGTGGGGAAGGGGGGTGG - Intronic
1003853037 6:10244238-10244260 CTTTAGAAGGTCAAGGTGGGTGG + Intergenic
1004300890 6:14456122-14456144 CTGTGGTGGGGGGAGGTGGGGGG - Intergenic
1004947041 6:20626968-20626990 CTGTAGACGGGGAAGGGAGAAGG + Intronic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1006138589 6:31912948-31912970 CTTTAGGAGGGCAAGGTGGGAGG + Intronic
1006167270 6:32072272-32072294 CTGTGGCTGGGGCTGGTGGGAGG + Intronic
1006175240 6:32117451-32117473 CTGTGGGTGGGCAAGGAGGGTGG - Intronic
1006299837 6:33187836-33187858 GGGTAGATGGGGAGGGTGGGTGG + Intronic
1006557712 6:34882746-34882768 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1006984055 6:38166213-38166235 CTGTACGTGGGGGAGGTGGAGGG - Intergenic
1006984143 6:38166490-38166512 CTGTACGTGGGGGAGGTGGAGGG - Intergenic
1006992073 6:38223579-38223601 CTCTGGATGGCCAAGGTGGGAGG - Intronic
1007234721 6:40382328-40382350 CTTTAGATGTGGACAGTGGGTGG + Intergenic
1007780989 6:44254646-44254668 CAGCAGAAGGGGATGGTGGGAGG + Exonic
1007958675 6:45939433-45939455 CTGTAGGAGGCCAAGGTGGGTGG - Intronic
1008067156 6:47061872-47061894 CTGTAAATGGGGAGGGTGCTGGG + Intergenic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011290166 6:85768680-85768702 CTTTGGATGGGTGAGGTGGGAGG + Intergenic
1011419416 6:87155780-87155802 CTCTAGCTGGGGAAAGGGGGAGG - Intronic
1011429459 6:87269814-87269836 CTATTGAAGGGGAAGGTAGGAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013366601 6:109442091-109442113 CTGGAGGTGGGGAAGGGAGGTGG - Intronic
1013695336 6:112696506-112696528 CTTTTGATGGGGAAGGTAGCTGG + Intergenic
1013700310 6:112760265-112760287 TGGTAGGTGGGGAAGGTGTGAGG - Intergenic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015438238 6:133215970-133215992 CTGTGGGTTGGGAAGATGGGAGG - Intergenic
1016359439 6:143251787-143251809 GTGTAGATGTAGATGGTGGGAGG - Intronic
1017006348 6:150030268-150030290 TTCTAGAAAGGGAAGGTGGGAGG + Intergenic
1017042088 6:150315760-150315782 CTTTAGAAGGCCAAGGTGGGAGG + Intergenic
1018851681 6:167644933-167644955 CTGCAGGTGGGCAGGGTGGGCGG - Intergenic
1020022651 7:4878298-4878320 CTTTAGAAGGCCAAGGTGGGAGG + Intronic
1020239449 7:6381636-6381658 CTTTAGGAGGGCAAGGTGGGCGG - Intronic
1021281980 7:18731210-18731232 CTGCAGATGGGGGAGGGGAGAGG + Intronic
1021453900 7:20808386-20808408 CTGTATATGGGGCAGGAGAGGGG - Intergenic
1022339757 7:29456917-29456939 CTGCAGATGGGGAAGATGAAGGG - Intronic
1022404391 7:30073742-30073764 CTTTAGGAGGGCAAGGTGGGAGG + Intronic
1022475738 7:30708356-30708378 GTGTATCTTGGGAAGGTGGGAGG - Intronic
1023137229 7:37064738-37064760 CTGCAGATGGGGAAGGAGATAGG - Intronic
1023256592 7:38318645-38318667 GTGGCCATGGGGAAGGTGGGTGG - Intergenic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1025264956 7:57449257-57449279 CTGGGGATGGGGAGGGTAGGGGG + Intergenic
1025959420 7:66206652-66206674 CTGCAGATGGGGATGGAGAGGGG - Intronic
1026741759 7:72983285-72983307 CTGTAGGAGGCCAAGGTGGGCGG - Intergenic
1026801600 7:73403710-73403732 CTGTAGGAGGCCAAGGTGGGCGG - Intergenic
1026981063 7:74526783-74526805 CTGCTGATGTGGGAGGTGGGGGG + Intronic
1027101976 7:75381792-75381814 CTGTAGGAGGCCAAGGTGGGCGG + Intergenic
1028505588 7:91567119-91567141 CTGTATATGGGGATAGTTGGTGG - Intergenic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1029195726 7:98804022-98804044 CTGGAGTTGGGGAAGGAGCGAGG + Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029383526 7:100228623-100228645 CTTTAGGAGGCGAAGGTGGGAGG + Intronic
1029568120 7:101352707-101352729 CTGTAGAAGGCCAAGGCGGGCGG + Intergenic
1031939294 7:127770249-127770271 AAGTAAATGGGGATGGTGGGTGG + Intronic
1032083695 7:128872820-128872842 CTGGTGATGGGGGAGGAGGGAGG - Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032510790 7:132470775-132470797 CTGTAGCTGAGGAATGTGGGTGG + Intronic
1032700792 7:134377325-134377347 GTGTAAATGGGAAAGATGGGGGG - Intergenic
1033005525 7:137557816-137557838 CTGTTGATGGGCATGGTGGGAGG - Intronic
1033322004 7:140348193-140348215 GGGAAGGTGGGGAAGGTGGGAGG + Intronic
1033369911 7:140698135-140698157 CTGGAGCTGGGGCAGGTGTGGGG + Intronic
1034077839 7:148249830-148249852 CAGCAGATGTGCAAGGTGGGAGG - Intronic
1034699523 7:153084097-153084119 CTGGAGATGGGGCTGGTGGGAGG - Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035454400 7:158998695-158998717 ATGAAGATGGGGAGTGTGGGGGG - Intergenic
1035679349 8:1476774-1476796 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1035679362 8:1476826-1476848 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1035819808 8:2579272-2579294 TTTTAGATGGGGAAGATGGGGGG - Intergenic
1036124662 8:6051989-6052011 CAGCAGATGGGGAAGGGAGGAGG - Intergenic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1037033908 8:14142699-14142721 CTGGAGATGGGCCTGGTGGGAGG + Intronic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1038963316 8:32546857-32546879 ATGTAGATGGGAAGGGAGGGAGG - Intronic
1039120862 8:34144683-34144705 TTGGGGATGGGGTAGGTGGGTGG + Intergenic
1039493163 8:37963036-37963058 TTGTAGCTGGGGAAGGTGAGTGG + Exonic
1040088321 8:43368227-43368249 CTTTGGATGGACAAGGTGGGCGG - Intergenic
1041166572 8:55098314-55098336 CTGTAGCTGGAGAAGGGGCGTGG - Intergenic
1041439037 8:57874263-57874285 CTGTAATTGGTGAAGGTGGGAGG - Intergenic
1041569136 8:59316877-59316899 CTGTAATTGGGGAAGGAGAGAGG - Intergenic
1041586142 8:59522087-59522109 GTGGAGAGGGGGAGGGTGGGTGG + Intergenic
1041599166 8:59695214-59695236 CTGAAAATGGGTAAGGTGGAAGG + Intergenic
1042377166 8:68064919-68064941 CTCTAGGTGGTGAAGGTAGGGGG - Intronic
1042549609 8:69982691-69982713 CTGTAGGAGGCCAAGGTGGGTGG - Intergenic
1042667776 8:71225306-71225328 CTGGAGATGGGGAGGGTATGTGG + Intronic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1044624771 8:94226392-94226414 CTGTAGGAGGCCAAGGTGGGCGG + Intergenic
1045901907 8:107291884-107291906 CTGAAGATGGGGGGGGGGGGGGG + Intronic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1046988715 8:120423899-120423921 TTGTAGATTGGGAGGGAGGGTGG + Intronic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1049049486 8:140183242-140183264 CTGGGGATGGGGATGGTTGGTGG + Intronic
1049209190 8:141377481-141377503 CTTTAGCTGGGGTGGGTGGGGGG + Intergenic
1049217356 8:141414393-141414415 CTGTAGTGGTGGAAGGTGGCTGG + Intronic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049368435 8:142252038-142252060 CTGCAGATAGAGAACGTGGGCGG - Intronic
1049825863 8:144667385-144667407 CTGGAGATTGGGAAGGGGGTGGG - Intergenic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1049958666 9:716980-717002 CTGTGGGTGGGGGTGGTGGGGGG + Intronic
1049970389 9:817176-817198 CTGTAGGGGGCGAAGGTAGGTGG + Intergenic
1051023930 9:12582668-12582690 CTGTAGATGGAGGAGGTGGGAGG - Intergenic
1051308494 9:15742880-15742902 CTCAAGAGGGTGAAGGTGGGAGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051435278 9:17024014-17024036 CTGTAGGTTGGTAAGGTGGGAGG + Intergenic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1052821158 9:33138809-33138831 CTGTAGGTGGTGATGGTGGTGGG - Intronic
1052953652 9:34234535-34234557 CTGTGGGTGGCCAAGGTGGGAGG + Intronic
1055220621 9:73926654-73926676 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1055503917 9:76929160-76929182 CTCTAGAAGGTGGAGGTGGGAGG + Intergenic
1055913226 9:81374601-81374623 CTGCTGAGTGGGAAGGTGGGAGG - Intergenic
1056532432 9:87498631-87498653 CTGGAGGTGGGAAAGCTGGGTGG + Intronic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1058504403 9:105653736-105653758 TTGGAGGTGGGTAAGGTGGGTGG + Intergenic
1059131840 9:111760132-111760154 CTGTAGATAGGGAAGATGGCTGG - Intronic
1059174615 9:112158065-112158087 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1060487780 9:124060240-124060262 CTTTGGATGGCGAAGGTGGGAGG + Intergenic
1061747733 9:132752718-132752740 CTGCAGGTGGGGTGGGTGGGGGG - Intronic
1061947392 9:133916386-133916408 TTGTAGAAAGGGAAGGTGGTGGG + Intronic
1062173224 9:135146993-135147015 CTGTAGATCGTGAGGGTGGGTGG - Intergenic
1185481683 X:451079-451101 GTGTAGATGGGGGGGGGGGGTGG + Intergenic
1185747640 X:2584698-2584720 TTGCAGATGGGGAGGGTCGGGGG + Intergenic
1186319179 X:8405597-8405619 TTGTAGATGAGAAAGGTGGGAGG - Intergenic
1186740472 X:12512371-12512393 CTGTAGTTGGGGGTTGTGGGGGG - Intronic
1186933070 X:14416056-14416078 CTGAAGGTTGGGAGGGTGGGAGG + Intergenic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1187746126 X:22411317-22411339 CGGGAGATGGGGATCGTGGGGGG - Intergenic
1187912590 X:24124622-24124644 CAGGAGATCTGGAAGGTGGGAGG + Intergenic
1188514098 X:30966552-30966574 CTGTTGGAGGGGAAGGTTGGGGG + Intronic
1188590847 X:31833252-31833274 GTGTAGATGGGGGAGGAAGGGGG + Intronic
1189586869 X:42470766-42470788 CTGTTGAAGGGGAATCTGGGTGG - Intergenic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1190085816 X:47394287-47394309 CTGTAGGAGGCCAAGGTGGGAGG - Intronic
1190183159 X:48211211-48211233 CTGTAAGTGGAGAAGGAGGGAGG + Intronic
1190188871 X:48258900-48258922 CTGTAAATGGAGAAGGGGCGGGG + Intronic
1190304113 X:49072770-49072792 CTGGAGATAGGGCTGGTGGGAGG - Intronic
1190740946 X:53288393-53288415 CTGTTGCTAGGGAAGGAGGGAGG - Intronic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194628350 X:96252337-96252359 CTTTAGAAGGCTAAGGTGGGAGG - Intergenic
1195252595 X:103063567-103063589 CGGGAGATGGGGGAGTTGGGAGG + Intronic
1195688299 X:107604266-107604288 CTGTGGATCGGGGAGGGGGGTGG + Exonic
1195720544 X:107863578-107863600 CTGGAAATGGGGAATTTGGGTGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1197110752 X:122771520-122771542 CTACTGCTGGGGAAGGTGGGAGG - Intergenic
1197515034 X:127416800-127416822 CTGAAAATGAGGAAAGTGGGAGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198370152 X:135982372-135982394 CTGAAGATGGTGGAGGTGGAGGG + Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200746768 Y:6910479-6910501 CTGGAGCTGGGGCTGGTGGGAGG + Intergenic
1200787513 Y:7273659-7273681 CGGAAGATGGGGAGGCTGGGTGG - Intergenic
1201403017 Y:13623505-13623527 GTGTGGCTGGGGAAGGGGGGAGG - Intergenic
1201539171 Y:15087805-15087827 CTGTGGTGGGGGGAGGTGGGAGG - Intergenic