ID: 946920744

View in Genome Browser
Species Human (GRCh38)
Location 2:224579720-224579742
Sequence AACTAACTGAAGCTACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946920743_946920744 2 Left 946920743 2:224579695-224579717 CCTGATGAGTTAGCAAGCTTTTA 0: 1
1: 0
2: 0
3: 7
4: 109
Right 946920744 2:224579720-224579742 AACTAACTGAAGCTACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946920744 Original CRISPR AACTAACTGAAGCTACTTCC AGG Intronic
904589764 1:31605980-31606002 ATGAAACTGATGCTACTTCCTGG - Intergenic
908455852 1:64304275-64304297 AACTAACAGAAGTGATTTCCCGG + Intergenic
909212958 1:72847652-72847674 AAGTACCTGAAGCTGTTTCCAGG + Intergenic
909621590 1:77673847-77673869 AAATAACTGAAGATACTACATGG + Intronic
909895016 1:81057946-81057968 AACTATATGAAGATATTTCCAGG - Intergenic
910804522 1:91177327-91177349 AAGTAACTAAAGCCATTTCCAGG - Intergenic
913037601 1:114987031-114987053 CACTGGCTGAAGCAACTTCCAGG + Intronic
914696965 1:150092627-150092649 AAATAACTGGAGGTATTTCCAGG + Intronic
915521320 1:156446080-156446102 GATTAAATGATGCTACTTCCGGG - Intergenic
918257198 1:182759389-182759411 AACTGACAGAAGCTGCTTTCTGG + Intergenic
918805708 1:189040153-189040175 AACAAAATGAAGCTATTTCAGGG - Intergenic
919156631 1:193774592-193774614 GACTAACAGAAGCTCTTTCCTGG - Intergenic
919205318 1:194415103-194415125 AACTAACTGTTCCTTCTTCCTGG - Intergenic
920929483 1:210373520-210373542 AACTGACTGATGCTACTTTCAGG + Intronic
923611396 1:235498497-235498519 AACTAAATGATGGTACTTCAAGG + Intronic
924054449 1:240111827-240111849 AAGCAACAGAAGCTACTTCCTGG - Intronic
1064797067 10:19024493-19024515 AAATAACTGTAGCTATTTTCAGG - Intergenic
1071270018 10:83998398-83998420 AACTACCTCCAGCTCCTTCCAGG - Intergenic
1083238175 11:61365655-61365677 AGCTCACTGCAGCAACTTCCTGG - Intronic
1086721211 11:90123752-90123774 AATTAACTAAGACTACTTCCAGG - Intergenic
1087801296 11:102507313-102507335 AACTGACTGAAATAACTTCCAGG - Intergenic
1090656647 11:128850951-128850973 AACTAACTGAAGTTTCACCCTGG - Intronic
1090982631 11:131736834-131736856 AGATAAATGAAGCTCCTTCCAGG - Intronic
1092857309 12:12686251-12686273 AAGAAACTGAAGGTCCTTCCTGG + Intronic
1094066479 12:26366384-26366406 CACAATCTGAAGCTACTTTCTGG - Intronic
1094307843 12:29040641-29040663 AAGTAACTGATGCTACTACCTGG + Intergenic
1097446000 12:59671591-59671613 AACTGATTGAAGCTACTCCATGG - Intronic
1100415402 12:94367796-94367818 AACACTCTGAAGCTCCTTCCTGG + Exonic
1102944212 12:116971282-116971304 AGCTCACTGCAGCAACTTCCAGG - Intronic
1103266674 12:119636409-119636431 CAATAACTGAAGCTTCTACCAGG - Intronic
1103297654 12:119902123-119902145 AACTAACGGAAGTAATTTCCAGG - Intergenic
1104547443 12:129724978-129725000 AACTGATAGAAACTACTTCCAGG + Intronic
1105907885 13:24832216-24832238 AAATAAAAGAAGCTAATTCCTGG - Intronic
1106794479 13:33190291-33190313 AAGTAACTGAAGCCACATCCGGG - Intronic
1111023699 13:82490150-82490172 AACTAACTACACCTACTTGCTGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1114064460 14:19049635-19049657 AGCTCACTGCAGCCACTTCCTGG - Intergenic
1114097800 14:19350366-19350388 AGCTCACTGCAGCCACTTCCTGG + Intergenic
1114394272 14:22342697-22342719 TACTAACTGCAGTTACTTCAGGG - Intergenic
1115859871 14:37672441-37672463 AACTAACTGAAACTTCTTCAGGG + Intronic
1115913113 14:38278406-38278428 AAGAAACTGAAGCAATTTCCTGG - Intergenic
1122882404 14:104696010-104696032 CACTAACTGAAGCTGCATCTCGG - Intronic
1125433920 15:39625854-39625876 AACAAACTGGATCTACTTCCCGG - Intronic
1126180026 15:45776183-45776205 AGCTAACTGAACCTACCCCCAGG + Intergenic
1127451038 15:59116703-59116725 AACTAATTGAAGCTTCTTCCGGG - Exonic
1127828221 15:62725075-62725097 AGCCAGCTGAAGCCACTTCCAGG + Exonic
1129894743 15:79094890-79094912 AGCTAACTTAAGCACCTTCCAGG - Intergenic
1131023893 15:89123203-89123225 GACTACCTGAAGCAGCTTCCAGG - Intronic
1133800526 16:9081535-9081557 AAATAAATGGAGATACTTCCTGG + Intergenic
1135316792 16:21453929-21453951 AACAAACTGAAGATGCCTCCTGG + Intergenic
1135369715 16:21886172-21886194 AACAAACTGAAGATGCCTCCTGG + Intergenic
1135442099 16:22484952-22484974 AACAAACTGAAGATGCCTCCTGG - Intronic
1136313620 16:29434104-29434126 AACAAACTGAAGATGCCTCCTGG + Intergenic
1136327062 16:29535870-29535892 AACAAACTGAAGATGCCTCCTGG + Intergenic
1136441753 16:30275855-30275877 AACAAACTGAAGATGCCTCCTGG + Intergenic
1138296553 16:55890676-55890698 AACAAACTGAGGCTTATTCCTGG + Intronic
1138725426 16:59133068-59133090 CTCTAACTGAAGCAACTTCCTGG - Intergenic
1139888548 16:70229580-70229602 AACAAACTGAAGATGCCTCCTGG + Intergenic
1141712657 16:85708918-85708940 AGCTAACTGATGCCACTTGCGGG + Intronic
1147452678 17:40515639-40515661 AACACCCTGAAGCCACTTCCAGG - Intergenic
1155443176 18:25883366-25883388 AACTAACTCAGGCTACTTGGAGG + Intergenic
1155684724 18:28534619-28534641 GACTAACTGACTCTACTTCCAGG - Intergenic
1157093051 18:44659221-44659243 AATTAACTCAAGCTACTATCAGG - Intergenic
1158388120 18:57018112-57018134 AACTTACTGAAGCAACCTTCTGG + Intronic
1162587528 19:11569829-11569851 AAGTAACTGAGGTTACTTCTGGG - Intronic
1162633565 19:11947558-11947580 AATTACCTGAAGCTTCTTCTGGG - Exonic
1164694729 19:30234793-30234815 ACCTAAGTAAAGCTACTTCGTGG - Intronic
1165684021 19:37802446-37802468 CTCCAGCTGAAGCTACTTCCAGG - Intronic
926726716 2:16004409-16004431 AACCAAGTGAGGCTACATCCAGG + Intergenic
926732259 2:16044797-16044819 AAATAATGGAAGCTACTCCCTGG - Intergenic
930775714 2:55168100-55168122 AACTAACTGAAGAGAGTGCCTGG - Intergenic
933268688 2:80209744-80209766 AACTGACTGAAACAACTTGCAGG - Intronic
935074986 2:99732562-99732584 AACAAACTGTAGCTACATGCAGG - Intronic
935601048 2:104921592-104921614 CTCTGACTGAAGCAACTTCCAGG + Intergenic
937097276 2:119243519-119243541 TGATAACTGAATCTACTTCCTGG + Intronic
937207276 2:120244874-120244896 CACAGCCTGAAGCTACTTCCAGG - Intronic
938481736 2:131668665-131668687 AGCTCACTGCAGCCACTTCCTGG - Intergenic
940649495 2:156427219-156427241 CACTTACTGAAGATGCTTCCAGG + Intergenic
942775302 2:179574578-179574600 AATCAACTGTAGCTACTTACAGG + Intronic
946817869 2:223597697-223597719 AACCAAGTGAAGCGAGTTCCTGG - Exonic
946920744 2:224579720-224579742 AACTAACTGAAGCTACTTCCAGG + Intronic
947245424 2:228042152-228042174 ACCTAAATGCAGCTCCTTCCAGG - Intronic
948641241 2:239377264-239377286 CACTAACCGAAGCCACTGCCAGG + Intronic
1169167770 20:3439221-3439243 AAATGACTGAAGCTATTTCAAGG + Intergenic
1175468230 20:59207583-59207605 AACTAAGTGGGGCTGCTTCCTGG + Intronic
1175682727 20:61002701-61002723 AAATACCTGAAGCTGGTTCCAGG + Intergenic
1178062683 21:28869573-28869595 AAGTCACTTATGCTACTTCCAGG + Intergenic
1178248336 21:30975671-30975693 AACTTTCTGAAGCTAGTTACAGG + Intergenic
1178503739 21:33146627-33146649 CACTGCCTGAAGCTGCTTCCAGG - Intergenic
1180482949 22:15772257-15772279 AGCTCACTGCAGCCACTTCCTGG - Intergenic
950396036 3:12734761-12734783 GACTGACTGAGGCCACTTCCAGG - Exonic
954141995 3:48612362-48612384 AACCAACTGAAGCCAGTCCCTGG + Intergenic
955573560 3:60333374-60333396 AACTAACTGTATCTACTTCTTGG - Intronic
955663490 3:61326170-61326192 AAAAAGCTGAAGCAACTTCCTGG + Intergenic
957838102 3:85626494-85626516 AAGTAACTGATGCTATTTCTAGG + Intronic
965094317 3:164204100-164204122 AAATATGTGAAGATACTTCCTGG + Intergenic
974128463 4:57724266-57724288 AATTAAATAAAGCTACTTGCTGG + Intergenic
974734032 4:65905415-65905437 AAGAAACTGAGGCTAATTCCAGG + Intergenic
977183988 4:93914298-93914320 AAATAACTGAAACCACTACCAGG - Intergenic
980950190 4:139367836-139367858 AACTAACTGAAGGGATTTTCAGG - Intronic
983032589 4:162821633-162821655 AACTATTTGAATCTAGTTCCAGG + Intergenic
986589002 5:9349362-9349384 AACCAACTGTAGGTACTGCCTGG + Intronic
987848358 5:23317243-23317265 AACCTAGTGAAGCTGCTTCCAGG + Intergenic
989749672 5:44878042-44878064 ATCTACCTGATGCTACTTGCAGG - Intergenic
990440299 5:55837827-55837849 AACTGACAGAAGCTGGTTCCAGG - Intergenic
992175237 5:74143419-74143441 AAGTGACAGAAGCGACTTCCAGG - Intergenic
992753547 5:79883238-79883260 CTCTGACTGAAGCAACTTCCAGG - Intergenic
995749755 5:115441653-115441675 ATCTAACTGAAGCTGCTCACTGG + Intergenic
995787008 5:115841369-115841391 AAGTAACTGAATTTATTTCCGGG - Exonic
996376799 5:122819326-122819348 CACTAACTGAAACTACTCACCGG + Intronic
997957148 5:138287708-138287730 AAGAAACTGAAGCTACTTGTAGG + Intronic
998920878 5:147066377-147066399 TAATAATTGAAGCTACATCCAGG - Intronic
998973584 5:147619494-147619516 AAGTGACTCAAGCTGCTTCCAGG + Intronic
1001729126 5:173936125-173936147 AACTATCTAAAGCTACTTTTTGG + Intronic
1003794425 6:9584247-9584269 AACTACCCGAAACAACTTCCAGG - Intergenic
1003834199 6:10050358-10050380 CTCTAGCTGAAGCAACTTCCAGG + Intronic
1004261982 6:14117030-14117052 TGTTAACTGAAGTTACTTCCTGG + Intergenic
1007908709 6:45490800-45490822 AAGTAACTGAAGCTGATTCGAGG - Intronic
1007924464 6:45640374-45640396 AACCAACTGAAGATGCCTCCAGG + Intronic
1008909028 6:56713444-56713466 AATTAACTTCATCTACTTCCTGG + Intronic
1010116017 6:72312111-72312133 AATTAACTGATGCTACAACCTGG - Intronic
1011618016 6:89215556-89215578 GTCTAACTGAAACTACTTCTTGG - Intronic
1014503677 6:122226577-122226599 AACCAACTGAAGCGATTTCATGG - Intergenic
1015071745 6:129102772-129102794 AACTTTCTGATGCTACTGCCAGG + Intronic
1016742844 6:147546554-147546576 AAATAACAGAAGTCACTTCCAGG - Intronic
1017360775 6:153567089-153567111 AACTGACTGAAGTTCATTCCAGG + Intergenic
1026912630 7:74100163-74100185 AGCTCACTGTAGCCACTTCCTGG - Intronic
1032995232 7:137438556-137438578 ACCTAACTTAAGCTATTCCCAGG + Intronic
1040545523 8:48395886-48395908 AATTAAGAGAAGGTACTTCCTGG - Intergenic
1042739036 8:72022434-72022456 ACCTAACCTAAGCTGCTTCCTGG - Exonic
1045485066 8:102624543-102624565 AACTCACTTCAGGTACTTCCTGG - Intergenic
1045546964 8:103138420-103138442 AACCCACTGAGCCTACTTCCAGG + Intronic
1046677665 8:117129118-117129140 TACTAACTGAAACTCCTTGCTGG - Intronic
1050719254 9:8566603-8566625 CACTAACTGAAGCTTCTTGAGGG + Intronic
1051410450 9:16784883-16784905 AACTAAAACAATCTACTTCCAGG + Intronic
1054767963 9:69058367-69058389 CACTACCTGAAGTTACCTCCAGG + Intronic
1055265240 9:74487658-74487680 AGCTAACTGCAGCTACTTTAGGG - Intergenic
1056016720 9:82396641-82396663 AACTGACTGTATCTACTTCCAGG + Intergenic
1056052010 9:82778856-82778878 AAATCACTGAACCTATTTCCTGG + Intergenic
1058407588 9:104694077-104694099 AACTTACCAAAGCTACATCCAGG + Intergenic
1188145129 X:26602572-26602594 AAGACACTGATGCTACTTCCAGG - Intergenic
1189655064 X:43236323-43236345 AACTAACCGAAGGTACTAACTGG + Intergenic
1193980501 X:88176203-88176225 AAATAACTGATCCTGCTTCCAGG + Intergenic
1197976956 X:132175921-132175943 AACTAACTGAAAGTGCTTTCTGG - Intergenic