ID: 946923939

View in Genome Browser
Species Human (GRCh38)
Location 2:224607416-224607438
Sequence CAGAGGAACCCCAAATAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946923939_946923945 8 Left 946923939 2:224607416-224607438 CCGAGCTATTTGGGGTTCCTCTG No data
Right 946923945 2:224607447-224607469 CACTAAAGCTCATTTTTCATGGG No data
946923939_946923944 7 Left 946923939 2:224607416-224607438 CCGAGCTATTTGGGGTTCCTCTG No data
Right 946923944 2:224607446-224607468 CCACTAAAGCTCATTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946923939 Original CRISPR CAGAGGAACCCCAAATAGCT CGG (reversed) Intergenic
No off target data available for this crispr