ID: 946930299

View in Genome Browser
Species Human (GRCh38)
Location 2:224663948-224663970
Sequence TATTCAGAGCAGGCCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946930299_946930303 -9 Left 946930299 2:224663948-224663970 CCTCTGTGGGCCTGCTCTGAATA No data
Right 946930303 2:224663962-224663984 CTCTGAATACTGTGAGGTCTGGG No data
946930299_946930307 10 Left 946930299 2:224663948-224663970 CCTCTGTGGGCCTGCTCTGAATA No data
Right 946930307 2:224663981-224664003 TGGGGCAGGAGTCCAAATGGAGG No data
946930299_946930304 -8 Left 946930299 2:224663948-224663970 CCTCTGTGGGCCTGCTCTGAATA No data
Right 946930304 2:224663963-224663985 TCTGAATACTGTGAGGTCTGGGG No data
946930299_946930305 -4 Left 946930299 2:224663948-224663970 CCTCTGTGGGCCTGCTCTGAATA No data
Right 946930305 2:224663967-224663989 AATACTGTGAGGTCTGGGGCAGG No data
946930299_946930302 -10 Left 946930299 2:224663948-224663970 CCTCTGTGGGCCTGCTCTGAATA No data
Right 946930302 2:224663961-224663983 GCTCTGAATACTGTGAGGTCTGG No data
946930299_946930306 7 Left 946930299 2:224663948-224663970 CCTCTGTGGGCCTGCTCTGAATA No data
Right 946930306 2:224663978-224664000 GTCTGGGGCAGGAGTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946930299 Original CRISPR TATTCAGAGCAGGCCCACAG AGG (reversed) Intergenic
No off target data available for this crispr