ID: 946930302

View in Genome Browser
Species Human (GRCh38)
Location 2:224663961-224663983
Sequence GCTCTGAATACTGTGAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946930295_946930302 18 Left 946930295 2:224663920-224663942 CCTTTCTCTGGACCTTTAATTGT No data
Right 946930302 2:224663961-224663983 GCTCTGAATACTGTGAGGTCTGG No data
946930296_946930302 6 Left 946930296 2:224663932-224663954 CCTTTAATTGTTGCTTCCTCTGT No data
Right 946930302 2:224663961-224663983 GCTCTGAATACTGTGAGGTCTGG No data
946930294_946930302 26 Left 946930294 2:224663912-224663934 CCTCTTTTCCTTTCTCTGGACCT No data
Right 946930302 2:224663961-224663983 GCTCTGAATACTGTGAGGTCTGG No data
946930299_946930302 -10 Left 946930299 2:224663948-224663970 CCTCTGTGGGCCTGCTCTGAATA No data
Right 946930302 2:224663961-224663983 GCTCTGAATACTGTGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946930302 Original CRISPR GCTCTGAATACTGTGAGGTC TGG Intergenic
No off target data available for this crispr