ID: 946930305

View in Genome Browser
Species Human (GRCh38)
Location 2:224663967-224663989
Sequence AATACTGTGAGGTCTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946930296_946930305 12 Left 946930296 2:224663932-224663954 CCTTTAATTGTTGCTTCCTCTGT No data
Right 946930305 2:224663967-224663989 AATACTGTGAGGTCTGGGGCAGG No data
946930299_946930305 -4 Left 946930299 2:224663948-224663970 CCTCTGTGGGCCTGCTCTGAATA No data
Right 946930305 2:224663967-224663989 AATACTGTGAGGTCTGGGGCAGG No data
946930295_946930305 24 Left 946930295 2:224663920-224663942 CCTTTCTCTGGACCTTTAATTGT No data
Right 946930305 2:224663967-224663989 AATACTGTGAGGTCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946930305 Original CRISPR AATACTGTGAGGTCTGGGGC AGG Intergenic
No off target data available for this crispr