ID: 946930306

View in Genome Browser
Species Human (GRCh38)
Location 2:224663978-224664000
Sequence GTCTGGGGCAGGAGTCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946930301_946930306 -3 Left 946930301 2:224663958-224663980 CCTGCTCTGAATACTGTGAGGTC No data
Right 946930306 2:224663978-224664000 GTCTGGGGCAGGAGTCCAAATGG No data
946930299_946930306 7 Left 946930299 2:224663948-224663970 CCTCTGTGGGCCTGCTCTGAATA No data
Right 946930306 2:224663978-224664000 GTCTGGGGCAGGAGTCCAAATGG No data
946930296_946930306 23 Left 946930296 2:224663932-224663954 CCTTTAATTGTTGCTTCCTCTGT No data
Right 946930306 2:224663978-224664000 GTCTGGGGCAGGAGTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946930306 Original CRISPR GTCTGGGGCAGGAGTCCAAA TGG Intergenic
No off target data available for this crispr