ID: 946930616

View in Genome Browser
Species Human (GRCh38)
Location 2:224666787-224666809
Sequence CTGGGTCTCCAATTTACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946930616_946930623 11 Left 946930616 2:224666787-224666809 CCATCTGTAAATTGGAGACCCAG No data
Right 946930623 2:224666821-224666843 GTACAATTCAGTCAGAAGGACGG No data
946930616_946930622 7 Left 946930616 2:224666787-224666809 CCATCTGTAAATTGGAGACCCAG No data
Right 946930622 2:224666817-224666839 AGTGGTACAATTCAGTCAGAAGG No data
946930616_946930624 19 Left 946930616 2:224666787-224666809 CCATCTGTAAATTGGAGACCCAG No data
Right 946930624 2:224666829-224666851 CAGTCAGAAGGACGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946930616 Original CRISPR CTGGGTCTCCAATTTACAGA TGG (reversed) Intergenic
No off target data available for this crispr