ID: 946931468 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:224675702-224675724 |
| Sequence | GAGAGCAAGGAGAAGGCAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946931462_946931468 | 20 | Left | 946931462 | 2:224675659-224675681 | CCTTCTTCACATGATGGCAGCAA | No data | ||
| Right | 946931468 | 2:224675702-224675724 | GAGAGCAAGGAGAAGGCAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946931468 | Original CRISPR | GAGAGCAAGGAGAAGGCAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||