ID: 946931468

View in Genome Browser
Species Human (GRCh38)
Location 2:224675702-224675724
Sequence GAGAGCAAGGAGAAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946931462_946931468 20 Left 946931462 2:224675659-224675681 CCTTCTTCACATGATGGCAGCAA No data
Right 946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946931468 Original CRISPR GAGAGCAAGGAGAAGGCAGA GGG Intergenic
No off target data available for this crispr