ID: 946935336 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:224714430-224714452 |
| Sequence | CGGTGGTTTTCAATGGTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946935328_946935336 | 22 | Left | 946935328 | 2:224714385-224714407 | CCCACAGAGAATAGACTTGAAGT | No data | ||
| Right | 946935336 | 2:224714430-224714452 | CGGTGGTTTTCAATGGTGGATGG | No data | ||||
| 946935329_946935336 | 21 | Left | 946935329 | 2:224714386-224714408 | CCACAGAGAATAGACTTGAAGTA | No data | ||
| Right | 946935336 | 2:224714430-224714452 | CGGTGGTTTTCAATGGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946935336 | Original CRISPR | CGGTGGTTTTCAATGGTGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||