ID: 946935336

View in Genome Browser
Species Human (GRCh38)
Location 2:224714430-224714452
Sequence CGGTGGTTTTCAATGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946935328_946935336 22 Left 946935328 2:224714385-224714407 CCCACAGAGAATAGACTTGAAGT No data
Right 946935336 2:224714430-224714452 CGGTGGTTTTCAATGGTGGATGG No data
946935329_946935336 21 Left 946935329 2:224714386-224714408 CCACAGAGAATAGACTTGAAGTA No data
Right 946935336 2:224714430-224714452 CGGTGGTTTTCAATGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946935336 Original CRISPR CGGTGGTTTTCAATGGTGGA TGG Intergenic
No off target data available for this crispr