ID: 946936891

View in Genome Browser
Species Human (GRCh38)
Location 2:224731498-224731520
Sequence TGCTGTTTGTTCTACTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946936891_946936892 1 Left 946936891 2:224731498-224731520 CCATTATAGTAGAACAAACAGCA No data
Right 946936892 2:224731522-224731544 TCTTTATTCCTTATGCTATTAGG No data
946936891_946936896 17 Left 946936891 2:224731498-224731520 CCATTATAGTAGAACAAACAGCA No data
Right 946936896 2:224731538-224731560 TATTAGGGTGTGTTTGGTAAAGG No data
946936891_946936895 11 Left 946936891 2:224731498-224731520 CCATTATAGTAGAACAAACAGCA No data
Right 946936895 2:224731532-224731554 TTATGCTATTAGGGTGTGTTTGG No data
946936891_946936893 2 Left 946936891 2:224731498-224731520 CCATTATAGTAGAACAAACAGCA No data
Right 946936893 2:224731523-224731545 CTTTATTCCTTATGCTATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946936891 Original CRISPR TGCTGTTTGTTCTACTATAA TGG (reversed) Intergenic
No off target data available for this crispr