ID: 946940222

View in Genome Browser
Species Human (GRCh38)
Location 2:224762352-224762374
Sequence GAATATGTGGATCTAATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946940222_946940227 11 Left 946940222 2:224762352-224762374 CCAAGTATTAGATCCACATATTC No data
Right 946940227 2:224762386-224762408 TTTTCCAGGGTAAATTATAGAGG No data
946940222_946940226 -2 Left 946940222 2:224762352-224762374 CCAAGTATTAGATCCACATATTC No data
Right 946940226 2:224762373-224762395 TCTGTGTTGGATCTTTTCCAGGG No data
946940222_946940225 -3 Left 946940222 2:224762352-224762374 CCAAGTATTAGATCCACATATTC No data
Right 946940225 2:224762372-224762394 TTCTGTGTTGGATCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946940222 Original CRISPR GAATATGTGGATCTAATACT TGG (reversed) Intergenic
No off target data available for this crispr