ID: 946940562

View in Genome Browser
Species Human (GRCh38)
Location 2:224765750-224765772
Sequence AGCAACTCCGGCCCTACCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946940562_946940565 4 Left 946940562 2:224765750-224765772 CCGTGGGTAGGGCCGGAGTTGCT 0: 1
1: 0
2: 0
3: 14
4: 163
Right 946940565 2:224765777-224765799 TAATTACTCGAGTGCAGGTTTGG 0: 1
1: 0
2: 0
3: 0
4: 47
946940562_946940566 25 Left 946940562 2:224765750-224765772 CCGTGGGTAGGGCCGGAGTTGCT 0: 1
1: 0
2: 0
3: 14
4: 163
Right 946940566 2:224765798-224765820 GGTCCACTCCGCGCTTTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 18
946940562_946940564 -1 Left 946940562 2:224765750-224765772 CCGTGGGTAGGGCCGGAGTTGCT 0: 1
1: 0
2: 0
3: 14
4: 163
Right 946940564 2:224765772-224765794 TTTGCTAATTACTCGAGTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946940562 Original CRISPR AGCAACTCCGGCCCTACCCA CGG (reversed) Exonic
902402198 1:16164283-16164305 AGCAACCCCGGCCCTTCTCCTGG - Intergenic
904334211 1:29786473-29786495 AGAAAATGCGGACCTACCCAAGG - Intergenic
905516419 1:38565162-38565184 AGCAACTCCGGAGCTTCCCCTGG + Intergenic
906028484 1:42696835-42696857 AACAACGCCGGCCCTACCGCAGG + Exonic
911829940 1:102537345-102537367 AGCACCTCCAGCTCTAGCCATGG - Intergenic
912518618 1:110230791-110230813 AGCACCTCTGGGCCTGCCCAGGG + Intronic
912873108 1:113327985-113328007 AGCATCTCTGGACCTACCCTGGG - Intergenic
915752909 1:158228601-158228623 AGCATCTCCAGACCTGCCCAGGG + Intergenic
916341757 1:163744821-163744843 AGCATCTCCAGACCTGCCCAGGG - Intergenic
917986547 1:180326128-180326150 AGCATCTCTGGACCCACCCAGGG - Intronic
918323303 1:183384956-183384978 AGCAACTCCCACCCCACCCCTGG - Intronic
920085693 1:203414607-203414629 AGCAACACCTGGCCCACCCAGGG + Intergenic
922358028 1:224795282-224795304 AGCATCTCTGGACCTGCCCAGGG - Intergenic
922377216 1:224980522-224980544 AGCATCTCTGGACCTATCCAGGG + Intronic
922829164 1:228542481-228542503 AGAGACTCCTGGCCTACCCAAGG - Intergenic
924629274 1:245721692-245721714 AGCACCTCTGGACCTGCCCAGGG + Intergenic
1069805890 10:71124834-71124856 AGCACCTCAGCCCCAACCCAGGG - Intergenic
1072682544 10:97517372-97517394 AGCAGCTCCTCCTCTACCCAGGG - Intronic
1073106888 10:101037198-101037220 AGCCACTCCCGCCTTACCCATGG - Exonic
1073462880 10:103676702-103676724 AGCAGCTGCTGCCCAACCCATGG + Intronic
1074719793 10:116254541-116254563 AGCATCTCCTGCCCTACTGATGG + Intronic
1076716229 10:132365348-132365370 AGCAACTCCCGCCATAACCAGGG - Intronic
1080489816 11:32750724-32750746 AGCATCTCTGGACCTACCCTGGG - Intronic
1081033008 11:38110776-38110798 AGCAGCTCCAGCTCTAGCCATGG + Intergenic
1083770719 11:64865402-64865424 AGCACCCCCGGCACTGCCCAAGG + Intronic
1084122422 11:67077468-67077490 ACCCACTCCGGCCACACCCAGGG + Intergenic
1084128592 11:67117917-67117939 AGCTGCGCCGGCCCTGCCCACGG - Intergenic
1085980591 11:81719075-81719097 AGCAACTCTGAACCTACCCAGGG + Intergenic
1087472904 11:98600455-98600477 GGCAACTCTGGACCTACCCAGGG - Intergenic
1093507435 12:19884842-19884864 AGAAACACCTGCCCTACCCCTGG - Intergenic
1097071768 12:56360296-56360318 CGCAACTCCGCCCCTCCGCAGGG + Intergenic
1102560578 12:113759320-113759342 AGTAACTCCATCCCTGCCCATGG + Intergenic
1103461460 12:121108138-121108160 AGCATCTCTGGACCTTCCCAGGG + Intergenic
1103565809 12:121814685-121814707 AGCAACTCCGGCCCAGGCCGCGG + Exonic
1104130588 12:125890035-125890057 AGCAGCTGCAGCCTTACCCACGG + Intergenic
1105460286 13:20579250-20579272 AGCATCTCTGGACCCACCCAGGG - Intronic
1107408121 13:40134150-40134172 AGCAACCCAGGCCCCACCCCAGG - Intergenic
1110501375 13:76231882-76231904 AGCATCTCTGGACCTGCCCAGGG + Intergenic
1115133980 14:30086867-30086889 AGCATCTCTGGACCTATCCAGGG + Intronic
1116232563 14:42235755-42235777 AGGAACACCTGGCCTACCCAGGG + Intergenic
1116263535 14:42660729-42660751 AGCCACTCCAGCTCTAGCCATGG + Intergenic
1116485484 14:45443904-45443926 AGCCACTCCAGCTCTAGCCATGG + Intergenic
1118463814 14:66013232-66013254 AACAACGCCGGCCCTACCGCAGG - Intergenic
1118543618 14:66859048-66859070 AGCATCTCTGGACCTACCCTGGG + Intronic
1124844209 15:33274938-33274960 AGCATCTACTGACCTACCCAGGG - Intergenic
1127177950 15:56381961-56381983 AGCATCTCTGGACCCACCCAGGG - Intronic
1129331658 15:74830985-74831007 AGCAGCTGCTGCCCTGCCCAAGG - Exonic
1129642474 15:77394168-77394190 GGCATCTCTGGACCTACCCAGGG + Intronic
1129884733 15:79030260-79030282 TCCAGCCCCGGCCCTACCCAGGG - Intronic
1130297973 15:82660491-82660513 AGCAGCTCCAGACCTAGCCAGGG + Intronic
1132404861 15:101536116-101536138 AGCAACTCCTGACCTTCCCCTGG - Intergenic
1132718382 16:1303637-1303659 GGCCACTCCTGCCCTATCCAAGG + Intergenic
1141485228 16:84334367-84334389 AGCATCTCTGGGCCTATCCAGGG + Intergenic
1141493131 16:84388441-84388463 AGAAACTCAGGCCCTACCCTGGG - Intronic
1143413776 17:6729625-6729647 AGCATCTCTGGACCTCCCCAGGG + Intergenic
1143900673 17:10172325-10172347 CGCATGTCCGGCCCTGCCCAAGG + Intronic
1152643241 17:81457809-81457831 AGCAACCCCTGCCCTCCCCCCGG - Intronic
1152643267 17:81457870-81457892 AGCAACCCCTGCCCTCCCCCCGG - Intronic
1152643301 17:81457959-81457981 AGCAACCCCTGCCCTCCCCCCGG - Intronic
1152728540 17:81959254-81959276 AGCGGCTCTGGCCCTCCCCAGGG - Intronic
1154210128 18:12372528-12372550 AGCAATGCCATCCCTACCCAAGG + Intronic
1156977187 18:43237449-43237471 AGTATCTCTGGACCTACCCATGG - Intergenic
1158024922 18:52885262-52885284 AGCATCCCTGGACCTACCCAGGG - Intronic
1162275585 19:9651583-9651605 AGCAACACCTGGCCCACCCAGGG + Intronic
1162440133 19:10687579-10687601 AGCAACTATGGCCCTCCACAGGG + Exonic
1163225107 19:15955036-15955058 AGCAACTCTGGACCCACGCAGGG - Intergenic
1164385921 19:27770633-27770655 AGCAACTCCCGACCAACCCCAGG - Intergenic
1165266035 19:34664424-34664446 AGCAGCCCCAGCCCTGCCCAGGG + Intronic
928802979 2:35116220-35116242 GGCAACTCTGGACCTGCCCAGGG + Intergenic
929100009 2:38302381-38302403 AGCATCTCTGGACCCACCCAAGG + Intronic
929227088 2:39521948-39521970 AGCCACTCCAGCTCTAGCCATGG - Intergenic
930972179 2:57409039-57409061 AGCAACTCTGGACCCACCCAGGG + Intergenic
935915241 2:107942742-107942764 AGGAACACCTGGCCTACCCAGGG - Intergenic
936925365 2:117731174-117731196 AGCATCTCTGGACCTACCCTGGG + Intergenic
937853596 2:126656742-126656764 GGCAACTCCAGCCTTGCCCAGGG + Intronic
938149933 2:128873822-128873844 AGAAACTACGGCCTAACCCAAGG - Intergenic
942972190 2:181970676-181970698 AGCATCTCAGGACCCACCCATGG - Intronic
943493448 2:188585632-188585654 AGCCACTCCAGCTCTAGCCATGG - Intronic
946317168 2:218923967-218923989 AGCCACTCCAGCTCTAGCCATGG - Intergenic
946929218 2:224655710-224655732 AGCAACTCCGCCCCCAGCCCTGG + Intergenic
946940562 2:224765750-224765772 AGCAACTCCGGCCCTACCCACGG - Exonic
948077156 2:235173906-235173928 ACCACCTCCGGGCCTCCCCATGG - Intergenic
1171162316 20:22938984-22939006 AGCATTTCTGGCCCTTCCCATGG + Intergenic
1175252499 20:57617921-57617943 AGCTACCCGGGCCCTGCCCAGGG - Intronic
1177894313 21:26843100-26843122 AGCAGCCCAGGCCCTACCCGAGG - Intronic
1180055698 21:45358161-45358183 AGCAACTCGGGCCCCACACTCGG + Intergenic
1181550350 22:23635271-23635293 AGCAATCCCTGCCATACCCATGG - Intergenic
1181797965 22:25323732-25323754 AGCAATCCCTGCCATACCCATGG + Intergenic
1182376796 22:29854465-29854487 AGCCTCTCAGGTCCTACCCATGG + Intergenic
1183346947 22:37313226-37313248 ACCCACTCTGGCCCTGCCCATGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184845636 22:47083590-47083612 AGCAACTCCTGCCCAGCCCCAGG + Intronic
1185163096 22:49241341-49241363 CGCAACTCCGTCCCCACCCCTGG + Intergenic
949235954 3:1808256-1808278 AGGAACTCCTGGCCCACCCAGGG - Intergenic
951448995 3:22815404-22815426 AGCAGCTCCTCCCATACCCAGGG + Intergenic
955387747 3:58492468-58492490 AGCATCGCCCGCCCTACCCCTGG + Intronic
957900267 3:86480651-86480673 GGCAACTTCGGACCCACCCAAGG - Intergenic
959547371 3:107612849-107612871 AGCATCTCTGGACCCACCCAGGG - Intronic
964974839 3:162606111-162606133 AGCCACTCCAGCCCCAGCCATGG + Intergenic
966445196 3:179994540-179994562 AGCCCCTCTGGCCCTATCCAGGG - Intronic
968286299 3:197510826-197510848 ATCGACACCGGCCCCACCCAAGG + Exonic
968519910 4:1030572-1030594 AGAAACACCGGCTCTGCCCAGGG + Intergenic
969224110 4:5783486-5783508 AGCAGCTCAGGCCCCACACAGGG + Intronic
976556883 4:86460662-86460684 AGCAACACCTGGCCCACCCAAGG + Intronic
978143690 4:105347366-105347388 AGAATCTCAGGCCCTACCCCAGG + Intergenic
979969241 4:127114161-127114183 AGCCACTCCAGCTCCACCCATGG + Intergenic
985827917 5:2206436-2206458 ATGAACTCCGGCCCCAGCCATGG + Intergenic
986709448 5:10478077-10478099 ACCATCTCTGGCTCTACCCATGG - Intergenic
986837111 5:11651190-11651212 AGCCACTCCAGCTCTAGCCATGG + Intronic
988770468 5:34427702-34427724 AGCCACTCCAGCTCCACCCATGG - Intergenic
988811236 5:34787072-34787094 AGGAACACCTGGCCTACCCAGGG - Intronic
989434233 5:41392093-41392115 AGCACTTCTGGACCTACCCAAGG + Intronic
989618302 5:43359479-43359501 AGGAACACCTGCCCGACCCAGGG - Intergenic
989742890 5:44793160-44793182 AGGAACACCTGGCCTACCCAGGG + Intergenic
990671975 5:58141833-58141855 ATCCACACCGGCCTTACCCAGGG - Intergenic
997186316 5:131885070-131885092 AGCCACTCTGGACCTGCCCAGGG + Intronic
998291124 5:140915896-140915918 AGCATCTCTGGGCCTGCCCAGGG - Intronic
999531039 5:152463932-152463954 AGCATCTCAGGCCCCACCCCAGG + Intergenic
1001150012 5:169219147-169219169 AGCAGCTCCAGCCCTGCCCAGGG + Intronic
1002626714 5:180534639-180534661 AGCGACTCCGGCCCATGCCATGG - Intronic
1002626797 5:180534884-180534906 AGCGACTCCGGCCCATGCCATGG - Intronic
1005066122 6:21819722-21819744 TGCAACTTCGGCCCTGCCCCAGG + Intergenic
1005156995 6:22818843-22818865 AGCATCTCTGGACTTACCCAGGG - Intergenic
1006139907 6:31922123-31922145 AGCATCTCTGTCTCTACCCAAGG - Intronic
1007904733 6:45448217-45448239 AGCAACTCAGTGCCTGCCCATGG - Intronic
1009371237 6:62905768-62905790 AGCATCTCTGGACTTACCCAAGG + Intergenic
1011572540 6:88754702-88754724 AGGAACACCTGGCCTACCCAGGG + Intronic
1012679010 6:102154538-102154560 AGCAACTTTGGACCTACCCATGG + Intergenic
1013093817 6:106925703-106925725 ATCACCTCAGGCCCTACCAAGGG - Intergenic
1015805947 6:137108694-137108716 AGGAACACCTGACCTACCCAGGG - Intergenic
1022323999 7:29313484-29313506 AGCAGCCCTGGCCCTACCCGAGG + Intronic
1023488359 7:40711188-40711210 AGCAACTCCGACCCAGCCCCTGG + Intronic
1025743393 7:64221283-64221305 AGCAACACCTGGCCTGCCCAGGG - Intronic
1028186307 7:87789919-87789941 AGCATCTCTGGACCCACCCAGGG + Intronic
1032330484 7:130974789-130974811 AGCAGCTCCAGCTCTAGCCATGG + Intergenic
1036133678 8:6139567-6139589 AGCAAATCCGGCCCCACCCCGGG + Intergenic
1040955954 8:52980190-52980212 AGGAACACCTGGCCTACCCAGGG - Intergenic
1045041242 8:98226870-98226892 AGCATCTCTGGACCCACCCAGGG - Intronic
1045258037 8:100546352-100546374 AGCCACTCCGGCTCCAGCCATGG + Intronic
1046134660 8:110010952-110010974 AGCCACTCCAGCTCTAGCCATGG + Intergenic
1049238669 8:141525527-141525549 AGCAACTCCAGCCCCACCCCAGG - Intergenic
1049544066 8:143221436-143221458 CGCACCCCCGGCCCTCCCCAGGG - Intergenic
1049684023 8:143932099-143932121 CGCAGCCCCGCCCCTACCCAGGG + Intronic
1050085647 9:1962764-1962786 AGCCATTACTGCCCTACCCAGGG - Intergenic
1052208329 9:25870255-25870277 AGCTACTCCAGCTCTAGCCATGG - Intergenic
1052606450 9:30708394-30708416 AGGAACACCTGCCCCACCCAGGG - Intergenic
1053169099 9:35865738-35865760 AGAAACTCAGGACCTGCCCACGG + Intergenic
1053181163 9:35971749-35971771 AACAACGCCGGCCCTACCGCAGG - Intergenic
1055302121 9:74892576-74892598 AGCATCTCTGGACCCACCCAAGG + Intergenic
1055742790 9:79408085-79408107 AGCAAATCTGGGCCTACTCAGGG + Intergenic
1059023061 9:110597160-110597182 AGCTACTCCAGCTCTAGCCATGG - Intergenic
1061698113 9:132393377-132393399 AGGAACACCGGGCCCACCCAGGG + Intronic
1062540869 9:137041086-137041108 CTCAACTCCGCCCCTACCCAAGG - Exonic
1187618174 X:21020903-21020925 AGCATCTCTGGACCCACCCAGGG + Intergenic
1187651989 X:21419999-21420021 AGCACCTCTGGACCCACCCAGGG - Intronic
1189411807 X:40779407-40779429 AGCATCTCTGGACCTGCCCAGGG - Intergenic
1190015196 X:46820404-46820426 AGCACCTATGGACCTACCCAGGG + Intergenic
1191230083 X:58086898-58086920 AGAAACTCCTGACCTACCCTAGG + Intergenic
1191650329 X:63529945-63529967 GGCACCTCTGGACCTACCCAAGG + Intergenic
1192406099 X:70887612-70887634 AGCATCTCTGGACCCACCCAGGG + Intronic
1193088466 X:77468591-77468613 AGCACCTCTGGACCAACCCAGGG + Intergenic
1194023603 X:88724104-88724126 AGCACCTCTGGACCCACCCACGG + Intergenic
1194126252 X:90020739-90020761 AGAAACTGCTGCCTTACCCAAGG + Intergenic
1194340589 X:92700548-92700570 AGCATCTCTGGACCTGCCCAGGG - Intergenic
1194476951 X:94369886-94369908 AGCACCTCTGAACCTACCCAGGG + Intergenic
1194892474 X:99397743-99397765 AGCATCTCTGGACCCACCCAAGG - Intergenic
1194910115 X:99631118-99631140 AGCAACTCCAGCTCCAGCCATGG - Intergenic
1196357222 X:114809100-114809122 AGCAACTCCAGGCCTGCCCAGGG - Intronic
1196555585 X:117081008-117081030 TGCCACTCCAGCTCTACCCATGG + Intergenic
1196564560 X:117189535-117189557 AGCACCTCTGGACCTGCCCAGGG + Intergenic
1196625408 X:117871862-117871884 AGCATCTCTGGACCCACCCAGGG + Intergenic
1197838792 X:130723273-130723295 ACCAACTACAGCACTACCCAGGG + Intronic
1198788253 X:140314273-140314295 AGCACCTCTGGACCCACCCAGGG + Intergenic
1198927388 X:141814460-141814482 AGCACCTCTGGACCTACCCAGGG - Intergenic
1199277699 X:145965114-145965136 AGCATCTCTGGACCTGCCCAGGG + Intergenic
1200353719 X:155526268-155526290 AGCAGCTCCAGCTCTAGCCATGG + Intronic
1200648943 Y:5817286-5817308 AGCATCTCTGGACCTGCCCAGGG - Intergenic
1201405201 Y:13642969-13642991 AGCACTTCTGGACCTACCCAGGG + Intergenic