ID: 946941959

View in Genome Browser
Species Human (GRCh38)
Location 2:224778599-224778621
Sequence TACCCCAAGCTGCCACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946941959_946941961 -8 Left 946941959 2:224778599-224778621 CCCTCTTGTGGCAGCTTGGGGTA 0: 1
1: 0
2: 1
3: 18
4: 129
Right 946941961 2:224778614-224778636 TTGGGGTAGAACACGAAATATGG 0: 1
1: 0
2: 0
3: 5
4: 98
946941959_946941962 4 Left 946941959 2:224778599-224778621 CCCTCTTGTGGCAGCTTGGGGTA 0: 1
1: 0
2: 1
3: 18
4: 129
Right 946941962 2:224778626-224778648 ACGAAATATGGAGCAATTTTTGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946941959 Original CRISPR TACCCCAAGCTGCCACAAGA GGG (reversed) Intronic
900106663 1:984308-984330 TGCCCCTAGCGGCCACCAGAGGG + Intergenic
902135515 1:14301493-14301515 TACCCCAGCCTGCCACTACAGGG + Intergenic
903732079 1:25503972-25503994 ACCCCCCAGCTGCCACCAGAGGG + Intergenic
906242716 1:44251870-44251892 TCCCCCAAGCTGGCAGGAGAGGG - Intronic
906307545 1:44729430-44729452 TTCTCCAGGATGCCACAAGAGGG + Intergenic
909625261 1:77708319-77708341 TGCCCAAAGCTGCCACCAGAGGG - Intronic
910561364 1:88595566-88595588 TACCCTAAAATCCCACAAGATGG - Intergenic
915605768 1:156949322-156949344 GACCCCTAGCTGCCCCAGGATGG + Intronic
916242270 1:162652099-162652121 TTCCCCAAGCAGCCCCAACAAGG - Intronic
916350761 1:163847267-163847289 TGCACCAAGTTGACACAAGAGGG - Intergenic
919945425 1:202315783-202315805 GGCCCCAAGCTGGCACTAGAGGG - Intronic
920216387 1:204363840-204363862 TACCGCAAGAATCCACAAGAGGG - Intronic
920333910 1:205231078-205231100 TTCCCCATGCTCCCACAAGCAGG - Intronic
920674573 1:208030205-208030227 TACCCAAGGCTGCCAGAAGAAGG - Intronic
921533425 1:216313421-216313443 TACCCCAAGGTGCAACAGAATGG + Intronic
922223426 1:223626174-223626196 GACCCCCAGCTGCCTGAAGAAGG + Intronic
1064167088 10:12996037-12996059 TAAACAAAGCTCCCACAAGATGG + Intronic
1069523077 10:69141505-69141527 TACCTCACCCAGCCACAAGAGGG + Intronic
1072746549 10:97943462-97943484 TGCCCCAAGTGGCCACAAGATGG - Intronic
1073102243 10:101012397-101012419 CACCCCCAGCTGCCACAGGGTGG + Intronic
1075304836 10:121358615-121358637 TTCCCATAGATGCCACAAGAAGG + Intergenic
1076978021 11:190001-190023 TGCCCCCAGCGGCCAGAAGAGGG - Intronic
1085570969 11:77557735-77557757 TGGCCCAAAATGCCACAAGATGG - Intronic
1085644927 11:78216759-78216781 TACCCGCAGCAGCCACAAGTGGG - Exonic
1088449717 11:109968425-109968447 TACCCCAACCTTCCACAGGGAGG + Intergenic
1088641328 11:111875979-111876001 TACCCTTTGCTGCCACAGGAAGG - Exonic
1088929805 11:114340389-114340411 TTCTCCAAGTGGCCACAAGATGG + Intergenic
1094505492 12:31057445-31057467 TACCCCAAGCCATCCCAAGATGG - Intergenic
1095968565 12:47885412-47885434 TAACAGAAGCTGCCGCAAGATGG - Intronic
1097798559 12:63888853-63888875 CACCCCAAGCTGCCACAGCTGGG + Intronic
1104262906 12:127201068-127201090 TGCCCCAGGATGCCACAACAAGG - Intergenic
1104479977 12:129099248-129099270 TACCCCAACCTGACGCAATAAGG - Intronic
1109299325 13:60574730-60574752 TACCCCATGCGGCCACAAGATGG + Intergenic
1114176679 14:20327445-20327467 AACCCAAGTCTGCCACAAGATGG + Intronic
1115260306 14:31445591-31445613 TTCCCCAAGGTCACACAAGAGGG - Intronic
1117338285 14:54773402-54773424 TACCTCCAGTGGCCACAAGATGG - Intronic
1119884085 14:78125701-78125723 TCCCCCACGGTGTCACAAGAAGG + Intergenic
1121865531 14:97359220-97359242 TTCTCCAAGCTCTCACAAGAGGG - Intergenic
1126357902 15:47815588-47815610 TAACACAGGCTGCCAAAAGAGGG + Intergenic
1126533499 15:49735086-49735108 CACCCCCAGCTGTCACAAGCAGG + Intergenic
1129300235 15:74621218-74621240 TGCCACATGCTGCCACAGGATGG + Intronic
1131076515 15:89498715-89498737 TACCCCAAGCTGGCACAGTGTGG - Intergenic
1132215636 15:100059726-100059748 CAACCCAAGCTGCCACAGAAGGG - Intronic
1137952437 16:52796519-52796541 TTCCCCAGTCTGCCACAACAGGG - Intergenic
1138590928 16:57999492-57999514 TACCTCATGCTGCCACAAAGTGG - Exonic
1142465446 17:134466-134488 TGCCCCCAGCGGCCAGAAGAGGG - Intergenic
1146809645 17:35892864-35892886 CACCCAAAGCTGACACTAGAAGG - Intergenic
1148450777 17:47776763-47776785 TTCCTCAAGCATCCACAAGAGGG + Intergenic
1148496713 17:48057216-48057238 TACCCCCAGCAGCCAGAATAAGG - Intronic
1148775648 17:50094429-50094451 TACCACATTCGGCCACAAGAGGG + Intergenic
1148892996 17:50821149-50821171 TAACCCAAGCTGCCTACAGATGG + Intergenic
1150867626 17:68870342-68870364 TTCCCCAAACTGTCCCAAGATGG - Intronic
1151817971 17:76480876-76480898 AAGCCCACGCTGCCACAAGCCGG + Intronic
1156525826 18:37766457-37766479 TGCCCCAAGCTGAGACAACAGGG - Intergenic
1160940467 19:1618359-1618381 TCCTCCAAGCAGCCACCAGAGGG + Intronic
1161385165 19:3987798-3987820 TACCACAAGCAGCCACAACCAGG + Intergenic
1161493684 19:4576165-4576187 TCCCCAAAGCTGCCACCAGAGGG + Intergenic
1162468642 19:10858667-10858689 TACCTCCAGCTGCCAGAAAACGG + Intronic
1166003065 19:39889738-39889760 CAGCCCAAGCTGCCACCGGATGG + Exonic
1166005852 19:39905990-39906012 CAGCCCAAGCTGCCACCGGATGG + Exonic
1166541201 19:43607336-43607358 GACCCCAAGGTTCCCCAAGAAGG + Exonic
1166838412 19:45681674-45681696 TACCCCGCGCTGCCGCCAGAGGG - Intronic
1167242275 19:48351434-48351456 TTCCCCAAGCAGCCACCAGAGGG + Intronic
926504947 2:13702424-13702446 TACTCCAAGATGCCACAACGTGG + Intergenic
931292842 2:60891320-60891342 TCCCCCAAGATTCCCCAAGAAGG - Intronic
932613356 2:73215895-73215917 TTCCTCAAGTTGCCACATGAGGG + Intronic
934609516 2:95724248-95724270 GACCCCAAGCTACTTCAAGAGGG - Intergenic
935221007 2:101012821-101012843 TTCAACAAGCTTCCACAAGATGG + Intronic
937383087 2:121399414-121399436 CACCCCATGCTGCCAGAAGAAGG - Intronic
941778263 2:169416368-169416390 TACCTCAAGACGCCACAAAAGGG - Intergenic
942483402 2:176413974-176413996 TCCCCCAGGCTCCCACAGGAAGG + Intergenic
943541460 2:189220085-189220107 TAGCTGCAGCTGCCACAAGAAGG + Intergenic
946191022 2:218008082-218008104 TATCCCCAGCTGACACGAGAAGG + Intergenic
946941959 2:224778599-224778621 TACCCCAAGCTGCCACAAGAGGG - Intronic
948175843 2:235942141-235942163 TAACCCAGGCTGACTCAAGAGGG - Intronic
948595548 2:239077111-239077133 TCACCTAAGCTGCCACAAGACGG + Intronic
1169430135 20:5529056-5529078 TCCCCCAAGGTACCACAAGATGG + Intergenic
1174418869 20:50386250-50386272 AACCAGAAGCTGCCAGAAGATGG + Intergenic
1174735087 20:52958461-52958483 TGCCCCAAACTGCAACCAGAAGG - Intergenic
1174879530 20:54263752-54263774 TCCCCCAAACTGCCATAATAAGG - Intergenic
1181756230 22:25026960-25026982 TGCCCCAAGCTACTACAAAATGG + Intronic
1182330727 22:29549930-29549952 TACCCAAAGTAGCCAAAAGAGGG - Intronic
950098616 3:10344310-10344332 TTCCTCAAGCTGCCACTAGAGGG + Intronic
952792734 3:37213178-37213200 TACTCCAAGTGGCCACAAGATGG - Intergenic
953331082 3:42053465-42053487 TATCCCCAGCTCCCCCAAGAAGG - Intronic
956777171 3:72575092-72575114 TACCCAATGCAGTCACAAGATGG + Intergenic
959455144 3:106550503-106550525 TACCCCAACCTGCCAAAGCAAGG - Intergenic
965103427 3:164332201-164332223 TACCCCAAGCTGTCTCACCATGG + Intergenic
965239314 3:166174303-166174325 TAGCCTAAGCTACCACAAAAGGG - Intergenic
966520474 3:180868957-180868979 TACCCCAAGCTGTCTCACGCTGG + Intronic
966618179 3:181934696-181934718 TACACCAAGCTGAAACAAAAAGG + Intergenic
967575630 3:191088219-191088241 TACTCAAAGCTGCAAGAAGAAGG + Intergenic
968372989 4:12114-12136 TGCCCCAAGCGGCCAGAAGGGGG - Intergenic
969350039 4:6593204-6593226 TTCCCCAAGCCTCCCCAAGATGG + Exonic
970691769 4:18629251-18629273 TTCTCCAGGCTGCCACAAGCAGG - Intergenic
971828957 4:31665230-31665252 TACCCCAAGCAGGCAAGAGACGG + Intergenic
972043609 4:34636779-34636801 TGCCCCAAACTGTCACAAAATGG + Intergenic
973084212 4:46034117-46034139 TACCTTATGCTGCCTCAAGAGGG + Intergenic
978172349 4:105688370-105688392 TAGCCCAAGATTACACAAGAAGG - Intronic
979546553 4:121946567-121946589 TCCCCCTATCTTCCACAAGATGG - Intronic
982519035 4:156390024-156390046 TACCTCAAGCTGCCTCACAATGG - Intergenic
985462406 4:190120453-190120475 TGCCCCAAGCGGCCAGAAGGGGG + Intergenic
987877197 5:23693076-23693098 GACCCCAAGCTCCTAGAAGAAGG + Intergenic
988608486 5:32703258-32703280 GACCCCAAGATGCCATTAGATGG - Intronic
989317764 5:40102588-40102610 TAACACAAGCTGCCTCCAGATGG + Intergenic
994163161 5:96579586-96579608 GGGCCCTAGCTGCCACAAGAAGG - Intronic
994600236 5:101893468-101893490 TAGCCCAACCTGCCAGAAGAAGG + Intergenic
994620139 5:102153501-102153523 TACCCATTGCAGCCACAAGATGG - Intergenic
994855139 5:105111011-105111033 AACCCCAAACTGCCTCAATAGGG + Intergenic
997225295 5:132205175-132205197 TACCCTGAGCTTCCACAGGATGG - Intronic
997604915 5:135167890-135167912 TTCTCCAAGCTGCAAGAAGAAGG - Intronic
999450974 5:151677911-151677933 TTCCACAAGCTGCCTCAAAAGGG - Intronic
1008742103 6:54621462-54621484 TACCCAATCCTGCCACAAGAGGG + Intergenic
1013645866 6:112140470-112140492 TACCCCCACCTGCCACAGGAAGG - Intronic
1014930326 6:127328027-127328049 TACCACAAGGTTCCAAAAGATGG + Intronic
1016670531 6:146700283-146700305 TACACAAAACTGCCACTAGAGGG - Intronic
1023259668 7:38345761-38345783 TGCTCTCAGCTGCCACAAGAGGG - Intergenic
1023260600 7:38354452-38354474 TGCTCTCAGCTGCCACAAGAGGG - Intergenic
1023261117 7:38359240-38359262 TGCTCTCAGCTGCCACAAGAGGG - Intergenic
1023261578 7:38363596-38363618 TGCTCTCAGCTGCCACAAGAGGG - Intergenic
1023262074 7:38368319-38368341 TGCTCTCAGCTGCCACAAGAGGG - Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1033098331 7:138449766-138449788 CCCCCCAGGCTGCCACAAGGGGG + Intergenic
1033684999 7:143630871-143630893 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033688172 7:143710090-143710112 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033699614 7:143826750-143826772 TAACCCAAGCTGCAACAAGGGGG + Intergenic
1039090332 8:33821300-33821322 AACCCCAAACTGACACAATATGG + Intergenic
1042083622 8:65084997-65085019 TATCTCTAGGTGCCACAAGATGG + Intergenic
1043516142 8:80996665-80996687 TACCCTCAGCTGCTCCAAGAAGG - Intronic
1045749126 8:105460348-105460370 TACCCGAAGCTGACAAATGAGGG + Intronic
1048574522 8:135680258-135680280 TGCTCCAAGCTTTCACAAGAGGG - Intergenic
1050531215 9:6591265-6591287 TAGACCAAGATGGCACAAGAGGG - Intronic
1054903386 9:70392706-70392728 TCCCCCAGGCTGCCAGACGAAGG - Intronic
1055506923 9:76957495-76957517 TGCCCTAAGCAGCCACAGGAAGG - Intergenic
1056886580 9:90449000-90449022 TACCCCCAGCAACCCCAAGAAGG - Intergenic
1058054754 9:100438048-100438070 TACCTCTAGCTGCCACTAGGTGG - Intronic
1058071246 9:100602519-100602541 TATTCCAATTTGCCACAAGATGG + Intergenic
1058157355 9:101530295-101530317 TACCCAATTCTGCCACAAGGTGG - Intronic
1059995458 9:119904614-119904636 TAACTCAAGCTTCCACCAGATGG + Intergenic
1060398469 9:123332982-123333004 TACCCCAAGCTTGCTCAGGAAGG + Intergenic
1185796813 X:2972527-2972549 TACCCCAAGCTGCCTCACCCTGG + Intergenic
1187671840 X:21675141-21675163 TTCCCCAAGCTCCCAAAAGTAGG + Intergenic
1188193966 X:27208039-27208061 TTTCCCTAGCTGCCACAAGTGGG + Intergenic
1189711217 X:43814229-43814251 TTCTCAAAGCTGCCAAAAGAAGG + Intronic
1189731515 X:44025778-44025800 TACACCAAGCTACCATCAGATGG + Intergenic
1192223145 X:69211027-69211049 TCCCCCCAGCTGCCACAGGCTGG + Intergenic
1195643861 X:107206793-107206815 TACCCCAAAAAGCCACAAGTTGG + Intronic
1198220989 X:134602050-134602072 TATCCCCAGCTGCCAGAAGAAGG - Exonic
1201231645 Y:11870701-11870723 TACCCCAAGCTGCCAGCAGCAGG - Intergenic