ID: 946942473

View in Genome Browser
Species Human (GRCh38)
Location 2:224784114-224784136
Sequence AAGTCTCCAGAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 395}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946942473_946942475 -8 Left 946942473 2:224784114-224784136 CCTTTCTCCATCTCTGGAGACTT 0: 1
1: 0
2: 7
3: 28
4: 395
Right 946942475 2:224784129-224784151 GGAGACTTACCCAGACATATTGG 0: 1
1: 0
2: 0
3: 7
4: 72
946942473_946942482 29 Left 946942473 2:224784114-224784136 CCTTTCTCCATCTCTGGAGACTT 0: 1
1: 0
2: 7
3: 28
4: 395
Right 946942482 2:224784166-224784188 CCTGGTTCATCTTTTATGTTTGG 0: 1
1: 0
2: 1
3: 17
4: 229
946942473_946942479 11 Left 946942473 2:224784114-224784136 CCTTTCTCCATCTCTGGAGACTT 0: 1
1: 0
2: 7
3: 28
4: 395
Right 946942479 2:224784148-224784170 TTGGGTAAAGATTTATTCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 130
946942473_946942476 -7 Left 946942473 2:224784114-224784136 CCTTTCTCCATCTCTGGAGACTT 0: 1
1: 0
2: 7
3: 28
4: 395
Right 946942476 2:224784130-224784152 GAGACTTACCCAGACATATTGGG 0: 1
1: 0
2: 1
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946942473 Original CRISPR AAGTCTCCAGAGATGGAGAA AGG (reversed) Intronic
900845596 1:5097858-5097880 TAATCTCCAGTGATAGAGAAGGG - Intergenic
901654241 1:10760230-10760252 CAGCCTCTGGAGATGGAGAAAGG + Intronic
902263695 1:15246626-15246648 ATGTTTGCAGAGATAGAGAAAGG + Intergenic
902715317 1:18268767-18268789 AGGTCTCCAGGGTTGGAGAAAGG + Intronic
903697657 1:25220210-25220232 AAGTACCTAGAAATGGAGAAGGG - Intergenic
904202912 1:28833273-28833295 CAGTCTCCTGAGCTGGAAAAGGG - Intronic
904211319 1:28888169-28888191 AGGGCTCCAGAGGCGGAGAAGGG - Intronic
905044836 1:34988527-34988549 AATTCTTCAGCAATGGAGAATGG + Exonic
905769157 1:40626163-40626185 GAGTCTCCAGGGATGGAGGTGGG - Exonic
907012464 1:50977182-50977204 CAGTCTCCAGAGACCGAGACAGG - Intergenic
908091577 1:60691226-60691248 AAGTCTTCAGAGATCAAGAGTGG + Intergenic
908223534 1:62033385-62033407 AAGGCTCCAGAGATGGAACCAGG + Intronic
908656470 1:66394124-66394146 GAGTCTCCAGAAATGCTGAAAGG + Intergenic
909090883 1:71224117-71224139 AACTCTCCAGAGTTCCAGAATGG + Intergenic
909802359 1:79826580-79826602 AAGTCTCTAGAGATGGGAATAGG + Intergenic
910000370 1:82333892-82333914 AACATTCCAGAGGTGGAGAAAGG - Intergenic
911151818 1:94603676-94603698 AAGGCTAAAGGGATGGAGAATGG + Intergenic
911505059 1:98738641-98738663 AACTCTTCATAAATGGAGAAGGG - Intronic
912024398 1:105148981-105149003 AAGCCTCCAGAAATTGGGAAAGG - Intergenic
912806787 1:112763153-112763175 AAGTCACCAGGGATTGAGAGGGG - Intergenic
912806799 1:112763282-112763304 TAGCCTCTAGAGAGGGAGAAAGG + Intergenic
915357213 1:155262481-155262503 TAGTCTCCCGAGATGGACGACGG + Intergenic
916299670 1:163259770-163259792 AAGTCTCAAGAGTTGGAAAGAGG + Intronic
917696957 1:177534984-177535006 TAATCTCCAGTGATGGAGACAGG - Intergenic
918133422 1:181648127-181648149 AAATCTCCACAGATTGAGAGGGG + Intronic
921181517 1:212635520-212635542 CAGTCTTCAGAGATGGATGAGGG + Intergenic
922899851 1:229128242-229128264 AAGTTTCCAGAGAGGAAGAGAGG + Intergenic
922914226 1:229242229-229242251 AAGTCTTCAGAAAAAGAGAAGGG + Intergenic
1063477195 10:6339685-6339707 CAGTGTCCACTGATGGAGAATGG + Intergenic
1063518676 10:6721371-6721393 AAGGGAGCAGAGATGGAGAATGG - Intergenic
1063619446 10:7632250-7632272 AAGTCTACAGGGATGAAGAGTGG + Intronic
1065240910 10:23703173-23703195 CAGTCTCCAGAGATCGGGAGTGG + Intronic
1067082881 10:43221545-43221567 AGGGCTCCGGAGAAGGAGAATGG + Intronic
1067778915 10:49184489-49184511 AAATCTACAGAAAAGGAGAATGG + Intronic
1068569079 10:58608319-58608341 AGCTCTCCAGTGATGGTGAAAGG - Intronic
1069398787 10:68019611-68019633 TAGACTCCAGAGTTGCAGAATGG - Intronic
1070180842 10:74012171-74012193 AGTTCTCCAGGGATGGAGAGAGG - Intronic
1070462026 10:76679779-76679801 AATTCTGAAGAGATAGAGAACGG - Intergenic
1070544859 10:77444347-77444369 AATTCTCCAAGGATGAAGAAAGG + Intronic
1071786704 10:88908857-88908879 AACTCTCAAGAGAAAGAGAAAGG - Intronic
1072135234 10:92539031-92539053 AAATCTCTAGAGATTGAGAGAGG + Intronic
1072386674 10:94937685-94937707 ACTTCTGCAGTGATGGAGAAGGG + Intergenic
1074915596 10:117951847-117951869 AAGTTTTCAGAGGTGAAGAAAGG - Intergenic
1074951354 10:118340318-118340340 AAGTCTTCAAAGTTGGAAAATGG + Intronic
1075438721 10:122462817-122462839 AAATCTGCAGAGGCGGAGAAGGG + Intronic
1076429505 10:130391692-130391714 AAGCGTCCAGAAATGGAGGAGGG + Intergenic
1078414085 11:11150889-11150911 AATTCTCAAGAGATGGGGTATGG + Intergenic
1078478045 11:11650928-11650950 CAGACTCAAGAGATAGAGAAAGG - Intergenic
1078563175 11:12390674-12390696 AAGTCTCAAGTGTGGGAGAATGG - Intronic
1079102037 11:17547796-17547818 AAGGCTGCAGGGAGGGAGAATGG + Intronic
1079580914 11:22063562-22063584 AAATCTTCAGTAATGGAGAAGGG - Intergenic
1080101237 11:28462218-28462240 AATTTTCCAGAAATGAAGAAAGG + Intergenic
1080438772 11:32271090-32271112 AAGACTACAAAGATGGAAAATGG + Intergenic
1082729053 11:56772713-56772735 AAGTCTCCAGAGCCTGAGATGGG + Intergenic
1082772863 11:57222052-57222074 AAGTCTTCAGTGAAGGAGGAAGG - Intergenic
1085815243 11:79730476-79730498 AAGTCTCCTGACAATGAGAAGGG - Intergenic
1087641045 11:100753834-100753856 AAGTCTCCAGAGTGTGAGAGAGG - Intronic
1088595784 11:111439269-111439291 AAGCCTCCAGAGGGGGAGAAAGG - Intronic
1089743213 11:120599368-120599390 GAGGCTCCAGGGATGGAGGAGGG + Intronic
1089936944 11:122374506-122374528 AAGTTGCCAGAAATTGAGAAAGG - Intergenic
1090426684 11:126611898-126611920 AAGTCACCAGAGAAGGACAGAGG - Intronic
1091125893 11:133096779-133096801 AAGTCATCAGAGATAGAGATGGG + Intronic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1092785621 12:12023905-12023927 AAGCATCCAGAGATGGAAATGGG + Intergenic
1095231124 12:39741481-39741503 AAGGCTTCAGATATGAAGAAGGG + Intronic
1095785960 12:46109431-46109453 AAGTCCCTAGAGTGGGAGAAGGG + Intergenic
1096145911 12:49278554-49278576 AAGTGTGCAGAGAGGGTGAAGGG - Intergenic
1096469010 12:51864668-51864690 AAGTCTCTAGAGAGGGCGCAGGG - Intergenic
1096596590 12:52699755-52699777 AAGTCTCAACAGATCTAGAAAGG - Intronic
1096730008 12:53601866-53601888 AAGTCTTCAGAGAAATAGAAGGG - Intronic
1097154903 12:57005881-57005903 GAATCTGGAGAGATGGAGAAAGG - Intronic
1098394107 12:70000272-70000294 AAGCATCCAGAGAAGGAGAGAGG - Intergenic
1100401035 12:94230104-94230126 CAGGCATCAGAGATGGAGAATGG - Intronic
1100891954 12:99135500-99135522 AAACTTCCAGAGAGGGAGAAAGG + Intronic
1102232289 12:111271519-111271541 AACTGTCCAGAGTTGGAGAGGGG - Intronic
1102505327 12:113381033-113381055 AAGTCCCCAGAGCAGGGGAAGGG - Intronic
1102991606 12:117320197-117320219 ATGTTTCCTTAGATGGAGAAAGG + Intronic
1104263156 12:127203859-127203881 TAGTCCCCAGTGATGGAGGAGGG - Intergenic
1106586546 13:31061738-31061760 AAGGCAACAGAGATGGTGAATGG + Intergenic
1107154220 13:37147461-37147483 AATTCTCCAGAGATGTGGATGGG - Intergenic
1107347447 13:39477118-39477140 AAGTCACTAGAGATGGGGGAGGG - Intronic
1107857152 13:44627804-44627826 AAGTTTGCTGTGATGGAGAAGGG - Intergenic
1108327645 13:49349141-49349163 AGCTCTCCAGAGGTGGAAAAAGG - Intronic
1108459029 13:50646680-50646702 AAATCTCCAGTCATGGAGAGAGG + Intronic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1108948611 13:56058062-56058084 AATCCTTCAGAGATGGAGATGGG + Intergenic
1109484302 13:62997901-62997923 AAGTCCCCAGAGTGTGAGAAGGG - Intergenic
1111206103 13:85013266-85013288 AATTCTACAGACATGCAGAATGG + Intergenic
1111595780 13:90408110-90408132 CAGTCACCAGAAATTGAGAAGGG - Intergenic
1111971434 13:94921320-94921342 TAGACTCCTCAGATGGAGAAGGG + Intergenic
1113135782 13:107087280-107087302 AAGTCAACAGGGAAGGAGAACGG - Intergenic
1113507428 13:110826886-110826908 AAGTGTCCAGTGATGGTGGATGG + Intergenic
1114365170 14:22018386-22018408 TAGTCTGTGGAGATGGAGAAAGG - Intergenic
1114544400 14:23487752-23487774 AGGTATAAAGAGATGGAGAAGGG + Intronic
1115529398 14:34313142-34313164 AAGTGTCCACACATAGAGAATGG + Intronic
1116863923 14:50016185-50016207 AAGGGTCCAGAGATGGGGATTGG + Intergenic
1118308810 14:64677606-64677628 AAGTCTTCAGAGATGGGCAGGGG - Intergenic
1118843007 14:69526857-69526879 GAGTCTCCAGGGAAGGGGAAGGG - Intronic
1119182993 14:72616934-72616956 AGGCCTCCAAAGATGAAGAATGG + Intergenic
1120219187 14:81713460-81713482 AAGTGAGCAGAGAGGGAGAAAGG + Intergenic
1121329445 14:93040748-93040770 CAGTCACCAGAGAAAGAGAATGG - Intronic
1121400843 14:93675644-93675666 TAGTCTCTAGAGAGGGAGTACGG - Intronic
1121506831 14:94484080-94484102 AAGGCTTCTGAGAAGGAGAAGGG + Intergenic
1121940435 14:98065004-98065026 CAGCCTGCAGAGCTGGAGAAAGG + Intergenic
1123156730 14:106234456-106234478 AAGTATGCAGAGAAGGAAAATGG + Intergenic
1123207503 14:106727557-106727579 AAGTATGCAGAGAAGGAAAATGG + Intergenic
1123810258 15:23917906-23917928 AAGTCTCCAGAAAGCAAGAAAGG - Intergenic
1124833304 15:33171195-33171217 TAGTTTCCAGAGACTGAGAAGGG + Intronic
1125128493 15:36253102-36253124 CAGGCTCCAGATATGGAGGAAGG + Intergenic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1128702701 15:69815801-69815823 AATTTTCCAGAAATGGAAAATGG - Intergenic
1128863745 15:71096455-71096477 AAGTCCCCAGAGAGGTAGGAGGG - Intergenic
1128949954 15:71868291-71868313 ATGTCTCTGAAGATGGAGAAAGG - Intronic
1129819068 15:78584140-78584162 AGGGCTCTGGAGATGGAGAATGG + Intronic
1130548643 15:84874852-84874874 AAGTATCCAGTGATGTACAAAGG + Intergenic
1130552458 15:84899317-84899339 AAGTCTCCAGAGGAGAAGGAGGG + Intronic
1130577981 15:85109268-85109290 GAGTCCACAGAGAGGGAGAAAGG - Intronic
1130682538 15:86009282-86009304 AATTCTCTAGAGATGGAGAATGG - Intergenic
1131826067 15:96323133-96323155 CAGTCTCCAGAGTAGGAGAAAGG - Intergenic
1132360546 15:101209651-101209673 AAGTCAGCAGAGGAGGAGAAAGG + Intronic
1132814191 16:1818098-1818120 GAGTCCCCAGAGATAGGGAAGGG + Intronic
1133053948 16:3135424-3135446 AAGTCACCAGAGGATGAGAATGG + Intronic
1135066025 16:19310734-19310756 AAGTCTATAGAGATGGAAAGTGG + Intronic
1136694674 16:32066939-32066961 AAGTCTACAGAGATGGAAAATGG - Intergenic
1136795176 16:33010201-33010223 AAGTCTACAGAGATGGAAAATGG - Intergenic
1136870041 16:33798560-33798582 AAGTCTACAGGGAAGGAAAATGG - Intergenic
1136874740 16:33844181-33844203 AAGTCTACAGAGATGGAAAATGG + Intergenic
1137586038 16:49664502-49664524 GATTCTACAGAGATGGAGGAGGG + Intronic
1137803480 16:51282849-51282871 AGGACACCAGAGATGGAAAAAGG + Intergenic
1139483514 16:67243992-67244014 AAGGCTCCTGAGATGTAAAAAGG + Intronic
1203097431 16_KI270728v1_random:1271861-1271883 AAGTCTACAGAGATGGAAAATGG - Intergenic
1203102129 16_KI270728v1_random:1317494-1317516 AAGTCTACAGGGAAGGAAAATGG + Intergenic
1142992139 17:3738559-3738581 ACGTCTGCAGCGATGGAGACAGG + Intronic
1143128734 17:4662522-4662544 CAGTCTCCCGAGAAAGAGAAAGG - Intergenic
1144888200 17:18478021-18478043 TAGACTCCAGAGAGGAAGAATGG + Intronic
1144968138 17:19090454-19090476 AGGTCCCCAGAGAGTGAGAAGGG - Intergenic
1144979779 17:19161609-19161631 AGGTCCCCAGAGAGTGAGAAGGG + Intergenic
1144988443 17:19216623-19216645 AGGTCCCCAGAGAGTGAGAAGGG - Intronic
1145144006 17:20466282-20466304 TAGACTCCAGAGAGGAAGAATGG - Intronic
1146208949 17:30926976-30926998 AAGACACCAAAGATGGAGAGGGG - Intronic
1146619536 17:34386698-34386720 GATTTCCCAGAGATGGAGAAGGG - Intergenic
1148000097 17:44382829-44382851 GAGTGTCCAGAGAGGGAGGAGGG - Intronic
1148126022 17:45237377-45237399 AAGACTCTAGATACGGAGAAAGG - Intronic
1148220814 17:45860528-45860550 AAGTCACCAGAGGTGGGGAGAGG - Intergenic
1148633222 17:49128243-49128265 CACTTTCCAGAGAGGGAGAATGG + Intergenic
1150031137 17:61736593-61736615 AAGTCTCCAGGAATGGAGAGTGG + Intronic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1152558420 17:81066116-81066138 AGGCCTCCAGAGATGGGAAAGGG - Intronic
1152576247 17:81142556-81142578 AATGCTCCAGAGCTGGACAATGG - Intronic
1153113365 18:1621579-1621601 AGGTCTACAGGGAGGGAGAAGGG + Intergenic
1153229814 18:2924981-2925003 GACTCTCAAGAGATGGAGGAAGG + Intronic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1155248961 18:23937666-23937688 AAGACTCCAGAGAGGGAGCAAGG + Intronic
1155284652 18:24275254-24275276 AGGTCCCCAGAGAAGCAGAATGG + Intronic
1156172681 18:34505360-34505382 AACTCTTCAGATAAGGAGAATGG - Intronic
1156602607 18:38627184-38627206 AAGTTTTCAGAGATGATGAAGGG + Intergenic
1156616289 18:38788970-38788992 AAGTCTAGAAAGATGCAGAAAGG + Intergenic
1157475262 18:48019996-48020018 AAGTGTAGAGAGTTGGAGAAGGG + Intergenic
1159503011 18:69298125-69298147 TAGTTTCTAGAGATGGGGAAGGG - Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1162719848 19:12655964-12655986 AAGAGTCCTGAGATGGGGAAAGG + Intronic
1164669270 19:30063526-30063548 AAGACTCTAGGGAGGGAGAAGGG + Intergenic
1166643279 19:44512610-44512632 AAGTCTTCTGAGATTGAGAAAGG + Intronic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1166851473 19:45763487-45763509 AAGGCTCCAGAGACAGAGCAGGG - Intronic
1167744059 19:51340675-51340697 AAGGCTCCAGAGACAGAGGAGGG - Exonic
925812262 2:7712172-7712194 AATTGGCCAGAGATGAAGAAAGG - Intergenic
925880672 2:8349816-8349838 AAGACACCAGAGATGAAGATGGG + Intergenic
926219189 2:10923914-10923936 AAGTACCCAGTGTTGGAGAAAGG + Intergenic
926266771 2:11330678-11330700 AAGTCTCAAAAAAAGGAGAAGGG + Intronic
926405618 2:12549442-12549464 AAGGCTCCAGACATGGAGCCAGG + Intergenic
926512849 2:13803743-13803765 AAGTATCCTGAGGTGGACAATGG - Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
927106758 2:19834312-19834334 AAGTCCCCAGTGTTGGAGGAGGG - Intergenic
927236663 2:20881145-20881167 AAGTCTGCAGAAATGAAGAGAGG - Intergenic
927324244 2:21784975-21784997 TATTCTCTAGAGATGGTGAAAGG + Intergenic
927580360 2:24238347-24238369 AAGTTTCCGGAGATGAGGAAAGG + Intronic
930289397 2:49474810-49474832 TAATCCCCAGTGATGGAGAAGGG + Intergenic
930762800 2:55053960-55053982 AAGACTGGAGAGAAGGAGAAGGG + Intronic
931138233 2:59428367-59428389 AAGTCTCCAGAAGTAGAAAAAGG + Intergenic
931867783 2:66431084-66431106 ATCTTTCCAGAGATAGAGAACGG - Intergenic
932163313 2:69482497-69482519 AAATCTCCAGATATCAAGAAAGG + Intronic
932427874 2:71654245-71654267 AAGTGTACAGTGATGGTGAAAGG + Intronic
934574498 2:95391576-95391598 AAGGCTTCATGGATGGAGAATGG - Intergenic
934680779 2:96282539-96282561 TAGTCTCCAGTGTTGGAGGAAGG + Intronic
934987928 2:98900700-98900722 TGGTCCCAAGAGATGGAGAAAGG + Intronic
936559060 2:113520694-113520716 AAGCCTCCATAGGTGGGGAAGGG + Intergenic
936963237 2:118099019-118099041 AAGTTGCCAGAGATGGAAAATGG + Intronic
937596009 2:123674298-123674320 CAGTCTGCAAACATGGAGAAAGG + Intergenic
939073293 2:137569124-137569146 CTGCCTCCGGAGATGGAGAAAGG + Intronic
939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG + Intronic
941035643 2:160566093-160566115 AGAACTCCAGAGATGGAGGATGG + Intergenic
941426198 2:165348424-165348446 AAGTCCCCAAAGATAGAGAAAGG + Intronic
941438726 2:165506560-165506582 AAGTCACCAGAGATCAAGAGTGG - Intronic
942684683 2:178518980-178519002 AAGTCTCCAGCGATGTTGAGGGG - Intergenic
944601976 2:201312683-201312705 AAGGCTACAGAGATGGTGGACGG + Intronic
944683538 2:202097954-202097976 AAGTCTCAAGAAATGGCAAAGGG - Intronic
946176572 2:217925733-217925755 AAGTTTCTAGAAATGGATAATGG - Intronic
946611471 2:221463008-221463030 AAGCCTCCAAAGATGGACTAGGG + Intronic
946873943 2:224110033-224110055 AAGTCCCCAGAGTGTGAGAAGGG + Intergenic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
946981802 2:225225958-225225980 AAAACTACAGAGATGGAGAAAGG + Intergenic
947206783 2:227667998-227668020 CGATCTCAAGAGATGGAGAAAGG - Intergenic
947354370 2:229276758-229276780 AAGTCAGCTCAGATGGAGAAAGG - Intergenic
947401753 2:229737250-229737272 AAGTCTCAAGAGTTTGAGACTGG + Intergenic
948269220 2:236661430-236661452 GAGTCCCTAGTGATGGAGAAGGG - Intergenic
948302019 2:236914661-236914683 AAGCCTCGAAAGATGGGGAAGGG + Intergenic
1168996200 20:2135045-2135067 AAGTCTCCAGAGGGGGAGTAGGG + Intronic
1169852804 20:10070833-10070855 ATGTCCCCAGTGTTGGAGAAGGG - Intergenic
1169900946 20:10551022-10551044 AACTCTTAAGAGATGTAGAAAGG - Intronic
1171422946 20:25030978-25031000 AAGCCATCAGAGATGGAGGAGGG + Intronic
1174104507 20:48152871-48152893 ATGTCTCCAGACATTGTGAACGG + Intergenic
1174957422 20:55114703-55114725 AAGTCTCCAAAGTTTGTGAATGG - Intergenic
1175283104 20:57818660-57818682 AAGTCTCCGATGAGGGAGAAGGG + Intergenic
1175636494 20:60588699-60588721 AAGTCACCAAACATGGAGAATGG - Intergenic
1175849741 20:62083357-62083379 AAGCCTCTAGAGATGGATGATGG - Intergenic
1178618072 21:34151278-34151300 TAATCTCCAGTGTTGGAGAAGGG - Intergenic
1178736393 21:35156307-35156329 AATTCTCCAGAGAAACAGAATGG + Intronic
1178791326 21:35702966-35702988 AGGCCTCCAGGGATGGAGGAAGG + Intronic
1178879098 21:36434390-36434412 AAGACTACAGAGTTAGAGAAGGG - Intergenic
1179191781 21:39128699-39128721 AAAGTTCCAGAGATGGATAATGG - Intergenic
1179657135 21:42852449-42852471 AGGTCTCCACAGAAGGTGAATGG - Intronic
1181063403 22:20293070-20293092 CTGTCTCCTGAGCTGGAGAACGG + Intergenic
1181952426 22:26564102-26564124 CAGTCTCCATAGTTGGAAAATGG - Intronic
1182023950 22:27102764-27102786 GAGACTCCAGAGATGGGGAGTGG - Intergenic
1183061589 22:35339554-35339576 AAGTCTCTAGAGAGGCAGAGAGG - Intronic
1183467837 22:37988819-37988841 AAATCACCAGGGATGGAGGAGGG + Intronic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1184382372 22:44153231-44153253 AGGTCTCCAGAAAAAGAGAAAGG - Intronic
1184748954 22:46473296-46473318 AAGTCCCCAGTGATGGTGGATGG + Intronic
1184848223 22:47102150-47102172 AAGGCGCCAGAGACTGAGAAAGG - Intronic
1185409828 22:50676029-50676051 AAGACTTCACAGCTGGAGAAAGG - Intergenic
949236994 3:1821362-1821384 AATTTTCCAGTGATAGAGAAAGG + Intergenic
950681496 3:14588363-14588385 CAGTGTCCAGAGAAGGAGAGAGG - Intergenic
951807071 3:26657454-26657476 AAGTCTCCTGGGATGGAACATGG + Intronic
952214428 3:31262853-31262875 ATGTCTTCAGGGATGAAGAAAGG - Intergenic
952521181 3:34159210-34159232 AACTCTCCAGAGAAAGTGAAAGG + Intergenic
952985392 3:38775244-38775266 AAGTTGCCAGAGAGGGGGAATGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954592852 3:51798630-51798652 GAGTCCCCAGACATGGGGAAGGG - Intergenic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
956517348 3:70063639-70063661 AAGTCAGCAAAGATGGAGACAGG - Intergenic
956541689 3:70347465-70347487 AACACAGCAGAGATGGAGAAGGG + Intergenic
956739716 3:72266339-72266361 AAGTTTACGGGGATGGAGAATGG + Intergenic
956775587 3:72562843-72562865 AAATCTCCAGAAATGGAGTGTGG + Intergenic
957162642 3:76629966-76629988 ATGTCAAAAGAGATGGAGAAAGG - Intronic
957501862 3:81067549-81067571 CACTTTCCAGAGAAGGAGAATGG - Intergenic
957594001 3:82236992-82237014 AAGGATGCAAAGATGGAGAAAGG + Intergenic
957677740 3:83392750-83392772 AAGTCTCCAGAGTGCAAGAAGGG + Intergenic
957755423 3:84478665-84478687 AATTTTCCAAATATGGAGAAAGG + Intergenic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
960051841 3:113246803-113246825 AGGTATCCAGAGAGGGAGAAAGG - Intronic
961467447 3:127090356-127090378 CAGTCTCCTGAGAGGGAGGAGGG - Intergenic
962254643 3:133862004-133862026 AATTCTCTGGAGATGGAGAAGGG - Intronic
962746261 3:138399206-138399228 CAGTCTCCTGAGCTGCAGAATGG + Intronic
963210695 3:142686503-142686525 AAGTTTGTAGAGATGGATAATGG - Intronic
963485194 3:145927090-145927112 ATGTCTACAGAGATGGATGAGGG + Intergenic
964082154 3:152772647-152772669 AAGTTTACAGAAAAGGAGAATGG + Intergenic
964700396 3:159559201-159559223 AACTCTGCACAGATAGAGAAAGG + Intronic
965014477 3:163139700-163139722 AGCTCTCCAGAGCTGGAAAATGG + Intergenic
965663207 3:171064181-171064203 TGGTCTCCAGAGATGCTGAAGGG + Intronic
966040076 3:175472976-175472998 AAGTATCCAGAAATAGAGGAGGG + Intronic
966498822 3:180613318-180613340 AAGTGTCCAGATTTGGAGATAGG + Intronic
967381964 3:188868949-188868971 AAGTGTGCAGACAGGGAGAAAGG + Intronic
967507702 3:190271652-190271674 AATGCTTCAGGGATGGAGAAAGG - Intergenic
967594583 3:191314702-191314724 CAACCTCCAGAGATGGGGAAGGG + Intronic
969129057 4:4977614-4977636 GAGGCACCAGAGAAGGAGAAAGG - Intergenic
969277192 4:6143925-6143947 CAGTCTCCAGGGCTGGAGCAGGG + Intronic
969624149 4:8293866-8293888 TACTCTCCAGGGATGGGGAAGGG + Intronic
969897059 4:10315314-10315336 AAGTGTCTAGAGATGGAGTCAGG + Intergenic
970365144 4:15350512-15350534 TAGTGGCCAGAGATGGAGAGAGG - Intronic
970642508 4:18082770-18082792 AAATCTCAACAGATGGAGACAGG - Intergenic
975120466 4:70722668-70722690 GAGTGTCCATGGATGGAGAATGG + Exonic
975163505 4:71150674-71150696 AAGTGTGCAGAGATGGAAATGGG + Intergenic
975641157 4:76501648-76501670 AATTCTCCAGAGAAGGGAAAGGG + Intronic
975927233 4:79471747-79471769 AAGCAGCCAGAGGTGGAGAAGGG + Intergenic
976303058 4:83533893-83533915 AAGTCTCAAGGAATGGAGGAGGG + Intergenic
977066554 4:92323707-92323729 AAATCACCAGAGAAGAAGAAAGG - Intronic
977301661 4:95274418-95274440 AAGTCCCCAGATATAAAGAAAGG + Intronic
978185972 4:105857762-105857784 AAGCTTCCAGAGAAGGAGCAGGG - Intronic
978239793 4:106501891-106501913 AAGTCTCCCCAGATGGAAACAGG + Intergenic
979037990 4:115749933-115749955 ATGTCCCCAGGGTTGGAGAAAGG - Intergenic
979361744 4:119773572-119773594 AAGCTTCCAGTCATGGAGAAGGG + Intergenic
980142873 4:128942383-128942405 AAGTCTCATGACATGGGGAAAGG + Intronic
980213571 4:129821677-129821699 AATTATTCTGAGATGGAGAAAGG - Intergenic
980509106 4:133761245-133761267 AAGTCTCAAGGTATGGAAAAGGG + Intergenic
980586815 4:134828768-134828790 AAGTTACTAGATATGGAGAATGG - Intergenic
981041393 4:140225849-140225871 AAGGCCACAGACATGGAGAATGG + Intergenic
981538601 4:145825267-145825289 AAGCCTGCAGAGCTGGAGGAAGG + Intronic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG + Intergenic
981705801 4:147658042-147658064 AGAACTCCAGAGATGGAAAATGG - Intronic
982089949 4:151871817-151871839 AAGTCTCCAGAAAGCTAGAATGG + Intergenic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
984858756 4:184218521-184218543 AAGCTTCCAGAGTTGGACAATGG + Intronic
985167408 4:187111604-187111626 AAGTCCCTAGAAGTGGAGAAGGG - Intergenic
986306479 5:6520404-6520426 AAGTCAGCAGAGATGGACCATGG + Intergenic
987555107 5:19436237-19436259 AAGTTTCCAGAGAGTGAGATGGG - Intergenic
988314734 5:29610146-29610168 AAGTTTGCTGAGATGGCGAATGG - Intergenic
988337970 5:29930640-29930662 GAGTCTCCAGAGGTCGAGATAGG + Intergenic
988660826 5:33266338-33266360 CAGCCTCCTGAGATTGAGAAAGG - Intergenic
989188884 5:38650512-38650534 AAATTTCCAGAGATGTGGAAAGG + Intergenic
989213435 5:38880067-38880089 CAGTCTGCAGAGAGTGAGAAAGG + Intronic
990516416 5:56534878-56534900 CATTCTCCAGAGATGGAGGGTGG - Intronic
992462207 5:76971799-76971821 AAGATTACAGAGATGGAGAATGG - Intronic
992938841 5:81741388-81741410 AAAGTTCTAGAGATGGAGAACGG + Intronic
993492728 5:88571432-88571454 AAATATCCATAGGTGGAGAAGGG + Intergenic
993492762 5:88571891-88571913 AATTATCCTGAGATGGAGACAGG - Intergenic
995196705 5:109378442-109378464 AAGTGTTCAAAGATGGAGAGAGG - Exonic
996084325 5:119288826-119288848 TAGTCTCCAAAGAGAGAGAAGGG + Intronic
996382653 5:122877807-122877829 AAGACTCCACCAATGGAGAAAGG - Intronic
997420592 5:133763830-133763852 CAGTCAGCAGAGGTGGAGAAGGG - Intergenic
997715123 5:136036815-136036837 AAGACTCCAGAGAAGGAGGCTGG + Intronic
998181405 5:139947999-139948021 AAAGCTCTGGAGATGGAGAATGG - Intronic
998922054 5:147080579-147080601 AAGTCTCCTGAGAACCAGAAAGG + Intronic
999939659 5:156528088-156528110 ATGACAGCAGAGATGGAGAAAGG + Intronic
1001239872 5:170060435-170060457 AATTCAACAGAGATGGAGGAGGG - Intronic
1001775422 5:174325940-174325962 CTGTCTCCAGAGAAGCAGAAGGG + Intergenic
1003432257 6:6050356-6050378 AAGTCTGCAGAGAAGTAGCATGG - Intergenic
1004251847 6:14029318-14029340 AAGTCTGCACAGGTGAAGAAAGG + Intergenic
1004508936 6:16268772-16268794 AAAGTTCCAGAGATGGATAATGG + Intronic
1006335288 6:33417380-33417402 AGGCTTCCAGAGCTGGAGAAAGG + Intronic
1006338386 6:33432557-33432579 AAGTCTCCAGAGGCGAGGAAAGG - Intronic
1006630491 6:35426969-35426991 AAGTCTCAAGAGAAGGAGGGGGG + Exonic
1006652434 6:35562808-35562830 AAGGCTCTGGAGAAGGAGAAAGG + Intergenic
1008202454 6:48607823-48607845 GAATCTTCAGAGATAGAGAAGGG + Intergenic
1008246335 6:49178475-49178497 TAATCTCCAGTGATGGAGATGGG - Intergenic
1008545725 6:52581586-52581608 AACTCTCCTGAGATGGATCAGGG + Intergenic
1009319379 6:62267470-62267492 AAGTGTTCAGAGAAGGAGACAGG + Intronic
1009663441 6:66645874-66645896 AAGTTTCCAAATTTGGAGAAAGG - Intergenic
1010301749 6:74268494-74268516 AAGTATATATAGATGGAGAAAGG + Intergenic
1010655275 6:78504411-78504433 AAGGCTCCACAAATGGATAATGG + Intergenic
1011121476 6:83958479-83958501 CAGTCAAGAGAGATGGAGAAGGG + Intronic
1012492788 6:99800784-99800806 AAGTTTCAAGAGATGCAGAAAGG - Intergenic
1012709897 6:102585571-102585593 AATTCTCCAGAAATAGAGGAGGG - Intergenic
1012931180 6:105318510-105318532 TGGTATCCAGAGAAGGAGAAAGG + Intronic
1013494850 6:110688568-110688590 AAGTCTCCTGAGTGTGAGAAGGG + Intronic
1015207416 6:130655609-130655631 AAGTGACCAGAGATGCAGAAAGG - Intergenic
1015258443 6:131207025-131207047 AAGTCAACAGAGATCGAGAGAGG - Intronic
1015355410 6:132272106-132272128 AAGTCTGCTGAGATGGGAAAGGG + Intergenic
1015717856 6:136210648-136210670 AAGTCTCCACAGCTGGTGGAAGG + Intergenic
1015812422 6:137174123-137174145 AGTTTTCCAGAGAGGGAGAAGGG - Intergenic
1015839740 6:137464169-137464191 AAGTGCCCAGAGATGGAGGAAGG - Intergenic
1016196200 6:141344929-141344951 AAATTTCCAGGGATGAAGAAGGG - Intergenic
1016552121 6:145293914-145293936 AAGTCTCTAGAAATAGAAAATGG + Intergenic
1021249139 7:18303183-18303205 AAGTTTTCAGAGATGGCAAATGG + Intronic
1022131509 7:27409185-27409207 TGGTCTCCCAAGATGGAGAATGG + Intergenic
1023165664 7:37341160-37341182 AAAGCTCCACAGATTGAGAAGGG + Intronic
1024084670 7:45883429-45883451 GGGTCCCCAGGGATGGAGAAGGG + Intergenic
1025074151 7:55927919-55927941 AAGCCACAAGAGATGGAGCAAGG + Intronic
1025254612 7:57375157-57375179 AAGTCTGCAGATCTGCAGAAGGG + Intergenic
1026624310 7:71978765-71978787 TAGTCACCAGAGATGGAGGATGG - Intronic
1028859963 7:95638066-95638088 AAGTCTTCATCAATGGAGAATGG - Intergenic
1029350770 7:100011338-100011360 AAGTATCCAGAGAGAGAGAGAGG - Intergenic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG + Intergenic
1031701021 7:124926892-124926914 GAGTGTACAGAGATGGACAATGG + Intronic
1031922174 7:127610144-127610166 AAGTCTCAGGATGTGGAGAAAGG - Intergenic
1032327826 7:130948479-130948501 AAGATTCCAGAGATGGATGATGG + Intergenic
1033453948 7:141485731-141485753 ATGCCACCAGACATGGAGAAAGG - Intergenic
1034346485 7:150388459-150388481 AGGCCTCCAGGGATGGAGAGTGG + Exonic
1034754007 7:153597357-153597379 AAGTCTCCAGCTTTGGAGAAGGG + Intergenic
1035120387 7:156561844-156561866 AGGTCTCCTGAGCTGCAGAATGG - Intergenic
1036238402 8:7062263-7062285 GAGGCTCCAGAGAAGGACAAGGG - Intergenic
1036372650 8:8174352-8174374 GAGGCTCCAGACAAGGAGAAAGG + Intergenic
1036402859 8:8425901-8425923 GAGTCTGCAGAGATAGAAAAAGG + Intergenic
1036878254 8:12491289-12491311 GAGGCTCCAGACAAGGAGAAAGG - Intergenic
1037036939 8:14179997-14180019 AAGTCACCAGAGATGCCAAAGGG + Intronic
1037289591 8:17336658-17336680 AAGTCTCTGGAGAAGGAGCAAGG + Intronic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1037565969 8:20118835-20118857 TAATCTCCAAAGTTGGAGAAGGG + Intergenic
1038950745 8:32411299-32411321 AAGTCTCCATAACTCGAGAAGGG - Intronic
1041907859 8:63053398-63053420 AAGTTTCCAGTCATGGTGAAAGG + Intronic
1041963096 8:63642586-63642608 CAGTCGCCAGAGATGAAGGAGGG - Intergenic
1042027595 8:64440444-64440466 AGGTCTCCAGATATGGAACAAGG + Intergenic
1043293888 8:78639926-78639948 AAGTCTACAGAGACAGAGAACGG - Intergenic
1043708299 8:83380408-83380430 AAGTCTCCAGGGATCAGGAATGG - Intergenic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1045115166 8:98973589-98973611 AAGTCGGCGGTGATGGAGAAGGG + Intergenic
1047416023 8:124665342-124665364 AGGTCTGCGGAGATGGAAAAAGG - Intronic
1047422220 8:124716612-124716634 AAGTCTCCTGGGATGGAGCCAGG + Intronic
1047844369 8:128789958-128789980 AATTCCCCAGAGATGAAGAAGGG + Intergenic
1047941745 8:129833079-129833101 CAGTCTCCAGCTATGGAGTAAGG - Intergenic
1048062884 8:130938514-130938536 AGGGCCCCAGAGCTGGAGAAGGG + Intronic
1048422007 8:134286044-134286066 AAGTATCCAGAGTAGGAGACAGG - Intergenic
1049060304 8:140271508-140271530 AAGTCAGGAGAGATGGGGAAGGG + Intronic
1049455084 8:142682604-142682626 GAGTCTCCAGAGATGGGGCCTGG + Exonic
1049893792 9:95487-95509 AAGCCTCCATAGGTGGGGAAGGG - Intergenic
1050241271 9:3638158-3638180 AAGTGACCAGAGGTGGCGAAGGG + Intergenic
1053735017 9:41095571-41095593 AAGCCTCCATAGGTGGGGAAGGG - Intergenic
1054693365 9:68335826-68335848 AAGCCTCCATAGGTGGGGAAGGG + Intronic
1055196794 9:73604279-73604301 AAGTCTGAAGAGCTGGAGACAGG - Intergenic
1055928288 9:81533028-81533050 AAGTCTCCAAAGAAGGAGTGGGG + Intergenic
1056513275 9:87326569-87326591 AAACCTCCAGGGAAGGAGAATGG + Intergenic
1056936868 9:90921651-90921673 AAGTTTCCAGAGAGAAAGAAGGG - Intergenic
1057187633 9:93065829-93065851 ATGTCTCCAGATATGGAGCTTGG + Intronic
1057851912 9:98572567-98572589 TTGTTTCCAGAGATGGTGAAGGG - Intronic
1058538054 9:105982800-105982822 AAATCTCAAGAGATAAAGAAGGG - Intergenic
1058595627 9:106612368-106612390 GAGCCTGCAAAGATGGAGAATGG - Intergenic
1059001132 9:110349917-110349939 AAGGATCCAGAGCTGGAGAGAGG + Intergenic
1059010330 9:110450902-110450924 AAGTGTCCAGTGAAGGAAAAAGG - Intronic
1059794301 9:117674798-117674820 AATTCTCCAGGGATGGAGAAGGG + Intergenic
1059918468 9:119130869-119130891 AAGGCTTCATAGATGAAGAAGGG + Intergenic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1185582005 X:1216978-1217000 AAGTCTGCAGAGAGAGAGAAAGG + Intergenic
1185798897 X:2991685-2991707 ATGTCTCCAGACATGGCCAAGGG - Intergenic
1186122791 X:6381798-6381820 CAGAATCCAGAGATGTAGAAGGG - Intergenic
1186556018 X:10559660-10559682 CAGTCCTGAGAGATGGAGAAAGG - Intronic
1186861012 X:13672577-13672599 AAATCTACAGAGATGGAAAGTGG + Intronic
1186979824 X:14946828-14946850 AAGTCTCCAGATGTGCTGAAGGG + Intergenic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1189573091 X:42320624-42320646 AAGTTTCCAGAGATGAATAAAGG + Intergenic
1189759574 X:44307105-44307127 AAGTCTCCAGAGAGGGTTACAGG + Intronic
1190190927 X:48276892-48276914 AAGTAGCCAGAGCTGGAAAAGGG + Intronic
1190452475 X:50595484-50595506 AAATCTCCTGAAATGGAGAAAGG - Exonic
1192223868 X:69215435-69215457 CAGTCTCCAGGGATGGAGGTGGG - Intergenic
1192475688 X:71440138-71440160 AAAACTATAGAGATGGAGAACGG - Intronic
1194439478 X:93913736-93913758 AAGTTTCCAGAGAAGTGGAAGGG - Intergenic
1195688332 X:107604459-107604481 ATGGCTCCAGAGAGGGAGAAAGG - Exonic
1196993783 X:121358329-121358351 AAGTCACCACATATGGGGAAAGG - Intergenic
1197603622 X:128559921-128559943 GAGTTTCCAGAGTGGGAGAAGGG + Intergenic
1198485710 X:137085552-137085574 AAGTCTCCAAAACTGGAGGAAGG - Intergenic
1199241497 X:145553308-145553330 AAGTCCCCAGAGAGGGAGAGAGG + Intergenic
1199482026 X:148308266-148308288 AAGTCTGCAGAGATGGAACGGGG + Intergenic
1199510052 X:148611682-148611704 GAGCCTCCCAAGATGGAGAATGG - Intronic
1199569804 X:149255983-149256005 TAGTCTCCAGGGATGGTGCAAGG + Intergenic
1200314489 X:155117470-155117492 AAGTCACCAGTGAGGAAGAAGGG + Intronic
1201866022 Y:18655952-18655974 AAGTCTGCAGACTTGGAGCATGG + Intergenic
1202237226 Y:22725349-22725371 CACTTTCCAGAGAGGGAGAATGG - Intergenic