ID: 946944597

View in Genome Browser
Species Human (GRCh38)
Location 2:224807716-224807738
Sequence TGCTCCTGGACAATATGCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946944597_946944605 28 Left 946944597 2:224807716-224807738 CCTTGGCATATTGTCCAGGAGCA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 946944605 2:224807767-224807789 TATCTGGGCCTGCTTTCTCTAGG 0: 1
1: 0
2: 2
3: 11
4: 226
946944597_946944604 13 Left 946944597 2:224807716-224807738 CCTTGGCATATTGTCCAGGAGCA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 946944604 2:224807752-224807774 CATGTATAAACTTGCTATCTGGG 0: 1
1: 0
2: 1
3: 18
4: 184
946944597_946944603 12 Left 946944597 2:224807716-224807738 CCTTGGCATATTGTCCAGGAGCA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 946944603 2:224807751-224807773 GCATGTATAAACTTGCTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 57
946944597_946944600 -10 Left 946944597 2:224807716-224807738 CCTTGGCATATTGTCCAGGAGCA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 946944600 2:224807729-224807751 TCCAGGAGCATGCCGTACAGGGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946944597 Original CRISPR TGCTCCTGGACAATATGCCA AGG (reversed) Exonic
903051401 1:20603879-20603901 TGCTGGGGGACAATAAGCCAAGG - Intronic
904977158 1:34465525-34465547 TGCTCCTGGAGAAAATATCAAGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906903306 1:49861521-49861543 TGCTCCTCTACAAAATCCCAGGG - Intronic
906946875 1:50301910-50301932 GGCTCCTGGCCTATCTGCCAGGG - Intergenic
907778092 1:57538449-57538471 TGCTGCTGGTCAAAATTCCAGGG - Intronic
909189915 1:72538926-72538948 TGATACTGGACAGAATGCCAGGG - Intergenic
913549824 1:119906678-119906700 GGCTCCTGAACAGTATGCCTGGG + Intergenic
918623064 1:186627183-186627205 TGCTCCTGCAGGAGATGCCAAGG + Intergenic
921033698 1:211356426-211356448 TGCTCCTGGATGTAATGCCAAGG + Exonic
921134234 1:212245777-212245799 TGCACCTTGACAACATGCTAAGG + Intergenic
921949141 1:220910970-220910992 TTCTCCTTAACATTATGCCAAGG - Intergenic
1068142699 10:53027221-53027243 TGCCCATGTCCAATATGCCAAGG - Intergenic
1076856726 10:133119603-133119625 TGCTCCTGGTGAAGATGCCGTGG - Intronic
1079321947 11:19458453-19458475 TGGTCCTGGGCAATTTCCCAAGG - Intronic
1080033435 11:27686972-27686994 TTCTCCTGGATAATATCCTAAGG + Intronic
1080103146 11:28482927-28482949 TCCTCCTGGACAATAGGATAAGG + Intergenic
1083480266 11:62939867-62939889 TGCTGCTGCATACTATGCCATGG + Intronic
1084657331 11:70527199-70527221 TGCTCCTGAACATTCTGCCTGGG + Intronic
1084730670 11:71071524-71071546 TGGTCCTGGACATTTTGCCCTGG + Intronic
1085057519 11:73414937-73414959 TGCTCCTGGAGAATGTGCTCTGG + Intronic
1086301667 11:85432742-85432764 TTCTGCTGGATAATATCCCAAGG - Intronic
1086433940 11:86763220-86763242 TGTTCCTGGACTAAGTGCCAAGG + Intergenic
1088391469 11:109319555-109319577 TGGTCCTGGACAATGTGATATGG - Intergenic
1092784712 12:12016764-12016786 GGCTGCTGGAGAAGATGCCAGGG - Intergenic
1097844887 12:64356136-64356158 TGCTCCTGGGCAACAGGCCCAGG - Intronic
1100149673 12:91721150-91721172 TGCTACTTGCCAATATGCCCAGG + Intergenic
1101246967 12:102892586-102892608 TGTTCCTGAATAATATTCCATGG - Intronic
1102164329 12:110794706-110794728 TGCCACTGCACAATATTCCATGG + Intergenic
1102482388 12:113232798-113232820 TGCTCATGGAGGATATTCCAAGG - Intronic
1104459651 12:128945063-128945085 TGCTCCGGGACAACATGCTGCGG - Intronic
1106831887 13:33593048-33593070 TGCACTAGGTCAATATGCCAGGG + Intergenic
1107179199 13:37438421-37438443 TGCTCCTGGACAAGGTACCATGG - Intergenic
1112571652 13:100598718-100598740 TGCCCCAGGACAATATGAAAGGG + Intergenic
1112727601 13:102322330-102322352 TGTTCCTGCACTCTATGCCAAGG - Intronic
1113177560 13:107582476-107582498 TGCTCCTGGATAGTTTGCAAGGG - Intronic
1114515006 14:23293493-23293515 AGACCCTGGACAATAAGCCATGG + Intronic
1115064235 14:29237042-29237064 TTCTCCTCCACAATATACCATGG + Intergenic
1115094796 14:29621884-29621906 TGCTCCTGGACCATATGAAAAGG - Intronic
1115367355 14:32573079-32573101 TGCTCCTGGACAGCTTGTCAGGG + Intronic
1119150059 14:72350605-72350627 TGTTGCTGGTCAATGTGCCAGGG - Intronic
1119817162 14:77580108-77580130 TGATCCTTGAAAATATGCAAAGG - Intronic
1122069117 14:99194365-99194387 TGCTCCTGGACAACATCCCTAGG + Intronic
1122070352 14:99201839-99201861 TGCTCCCGGGCTCTATGCCAGGG + Intronic
1122141210 14:99664133-99664155 TGTTCCTGGACAAAAGCCCAGGG + Intronic
1122883399 14:104700041-104700063 TGCTCCAGGACACTCTCCCAAGG + Intronic
1124926591 15:34075998-34076020 AGTTCCTGGACTACATGCCAAGG + Intergenic
1127769611 15:62220584-62220606 AGCTCCATGACATTATGCCATGG + Intergenic
1128535769 15:68489091-68489113 TGATTCTGGTCAATATGCTATGG - Intergenic
1130021139 15:80232864-80232886 TGAGCCTGGACATTATGCCCAGG - Intergenic
1131670528 15:94614979-94615001 TGCTCCTGGACAAGAAGAAAGGG - Intergenic
1133847128 16:9465679-9465701 TGCTCCTGGAAATTCTGTCAAGG + Intergenic
1137634186 16:49971391-49971413 AAGTCCAGGACAATATGCCAGGG + Intergenic
1138219721 16:55240394-55240416 TGCACCTGGAAAATATGCCCAGG + Intergenic
1142326453 16:89418500-89418522 AGCTCCTGGTCACTGTGCCAAGG + Intronic
1143539184 17:7559274-7559296 TGCTCCGGGAGACTCTGCCAGGG - Exonic
1144134477 17:12280139-12280161 AGCTCCTGCTCAATATGCCTTGG - Intergenic
1146957881 17:36947428-36947450 TGCTCCTTGACAAGGTGCCATGG - Intergenic
1146977213 17:37124010-37124032 TGTCCCTGGACAAGGTGCCATGG + Intronic
1147557951 17:41491542-41491564 TGCTCCTGGACATCTTGTCAAGG - Intronic
1147660124 17:42112921-42112943 TGCTCCTGATCCAGATGCCAGGG - Intergenic
1149557886 17:57587184-57587206 TGCTCCTAGACAATATATCAAGG - Intronic
1155252861 18:23968167-23968189 TGATCCTGGAGAAGATGCCCTGG - Intergenic
1156698274 18:39794419-39794441 TTTTCCTGAACAAAATGCCACGG + Intergenic
1158464286 18:57676006-57676028 TGCTCTTAGAAAATAAGCCAGGG - Intronic
1161031112 19:2058135-2058157 TGCTCCAGGCCACTCTGCCAGGG - Intergenic
1163366276 19:16877720-16877742 TGCTCCCAGACAGTGTGCCATGG - Intronic
1164359973 19:27495290-27495312 TGTTCTTGGAGAAAATGCCATGG + Intergenic
1166962303 19:46505313-46505335 TGCTCCTGGGACCTATGCCAAGG - Intronic
1168126285 19:54285411-54285433 TGCTCCTGGAGACTGTACCAAGG + Intergenic
925406443 2:3608529-3608551 TGCACCTGGCCAATTTGGCAAGG - Intronic
926129714 2:10295139-10295161 AGCTCCTGGTGCATATGCCAAGG - Intergenic
927316274 2:21686801-21686823 TTTTCCTTTACAATATGCCAGGG + Intergenic
928906009 2:36368423-36368445 TGCCGCTGGACAACATGCAAAGG - Intronic
936109553 2:109653731-109653753 CCTTCCTTGACAATATGCCAGGG + Intergenic
936743279 2:115541743-115541765 TTCTCCTGCACTATATGCCATGG + Intronic
936802161 2:116283043-116283065 TGCTCATGTCCATTATGCCAAGG + Intergenic
944541985 2:200762832-200762854 TCCTACAGGACAGTATGCCATGG + Intergenic
945685108 2:212959488-212959510 TCCTCCTGGAAAACATGCCCAGG - Intergenic
946345757 2:219109219-219109241 GGCAACTGGATAATATGCCAGGG + Intronic
946872573 2:224097569-224097591 TGCTCCTTGACACAAAGCCAGGG + Intergenic
946944597 2:224807716-224807738 TGCTCCTGGACAATATGCCAAGG - Exonic
947854298 2:233312878-233312900 TGCCCCTGGAATAAATGCCAGGG - Intronic
948653380 2:239462714-239462736 TGCTGCTGGTCAATGTGGCAGGG + Intergenic
1170236750 20:14114946-14114968 TGCTCCAGGGAAAAATGCCAAGG - Intronic
1172062672 20:32197054-32197076 TGCCCATGGGCAACATGCCAGGG + Exonic
1172744459 20:37196032-37196054 TGCTCCTGGAGAGTAGGACAGGG - Intronic
1173193343 20:40893814-40893836 AGATCCTGGGCAATATCCCAAGG + Intergenic
1175303734 20:57961403-57961425 TGGTCCTGGACAAGATTCCCAGG - Intergenic
1177838336 21:26210203-26210225 TGCTCCTGGCCATGATGACATGG - Intergenic
1181573511 22:23780372-23780394 TGCTCCTGCACCAACTGCCATGG - Exonic
1183505084 22:38204147-38204169 TTGTCCTGGACCAGATGCCAGGG + Intronic
1184329511 22:43818246-43818268 TGCTCCTGAACAAGATTCCGTGG + Intergenic
1185279868 22:49965451-49965473 TGCTCCTGGGCCAACTGCCATGG + Intergenic
949883411 3:8678200-8678222 TGCTCCTTCATAATATTCCAAGG - Intronic
949884039 3:8680712-8680734 TGCTCCTTCATAATATACCAAGG - Intronic
952068644 3:29604705-29604727 TGCTTCTGGATAATTTGCAATGG + Intronic
957445617 3:80310395-80310417 TGCCCATGTCCAATATGCCAAGG + Intergenic
957925513 3:86805556-86805578 GGCTCCTGGACAGCATGCCTAGG + Intergenic
959725775 3:109539752-109539774 TTCTCCTGGATAATATCCTACGG - Intergenic
960566982 3:119144364-119144386 TTATCCTGGAGAATATTCCATGG - Intronic
961528811 3:127526891-127526913 TCCTCAGGGACAATGTGCCAGGG + Intergenic
962468153 3:135679684-135679706 TGATCTTGGACAACCTGCCATGG - Intergenic
963051155 3:141145066-141145088 TGCACCTGGAAAATAGGGCATGG + Intronic
969067388 4:4497264-4497286 GATTACTGGACAATATGCCAAGG + Intronic
969185452 4:5471033-5471055 TGCTCCTGCAGAATATGCAGGGG + Intronic
971706865 4:30056309-30056331 GGGTCCTAGACAATAAGCCATGG + Intergenic
976367151 4:84244867-84244889 TGCCCATGGGCAACATGCCAGGG - Intergenic
977939831 4:102846314-102846336 TTCTCCTCTACAATATGCCCAGG + Intronic
978179378 4:105774922-105774944 TTCTCCTGGATAATATCCCAAGG + Intronic
979091614 4:116490147-116490169 GGCTCCTGGAAATTATGCAAGGG + Intergenic
981090198 4:140724181-140724203 TGGTCCGGGACACTGTGCCATGG - Intronic
984598869 4:181703961-181703983 CGTTCCTGGACAGTATGCCTGGG - Intergenic
987090392 5:14504375-14504397 TGCCCCTGTAAAATATGTCAGGG - Exonic
990333847 5:54753361-54753383 GGCTCCTGGACAGTATAGCAGGG - Intergenic
996510527 5:124310723-124310745 TCCTGCTGGGTAATATGCCACGG - Intergenic
997367126 5:133333197-133333219 TGCTCCTGGGCACTATGACCTGG - Intronic
1003485941 6:6579755-6579777 GACTCCTGCATAATATGCCAGGG - Intergenic
1011413316 6:87089044-87089066 TGTTGCTGGACAGTATTCCATGG - Intronic
1014324080 6:119969537-119969559 TGATTTTGGACAAAATGCCATGG + Intergenic
1014615975 6:123600203-123600225 TGCTCCTGGAATAAATGCCTGGG - Intronic
1021401459 7:20214115-20214137 TCCTCCTGCACACTATGCCCAGG + Intronic
1023388502 7:39684541-39684563 TGGGCCAGGACAATCTGCCATGG - Intronic
1024012466 7:45281107-45281129 TGTTCCTGAGCAATATCCCATGG - Intergenic
1025571996 7:62585651-62585673 TGCTCTTGTACAATCTGCAAAGG - Intergenic
1026443770 7:70466009-70466031 TGTTCCTGGTCAAGATGACATGG - Intronic
1028276278 7:88861854-88861876 TGCTACTGAAAAATATGCAAGGG - Intronic
1035449696 7:158968731-158968753 TACTTCTGGACAGTATGCCTTGG - Intergenic
1046489905 8:114937805-114937827 TTCTCCTGGAGGAAATGCCAAGG - Intergenic
1048059841 8:130907431-130907453 TGCACATTGACAACATGCCATGG + Intronic
1048164955 8:132054165-132054187 TGCTCCTAGCCAATGTCCCAGGG + Intronic
1049005346 8:139851922-139851944 TGCTCCTGGAGGGTCTGCCAGGG + Intronic
1050350938 9:4740944-4740966 TGCTCCGGGACAACATGCTGCGG - Exonic
1055499662 9:76890276-76890298 TGCTCTTGGTCAGCATGCCAGGG - Intronic
1056645118 9:88404981-88405003 TTCACCTGGACAAGATGCCGAGG - Intronic
1060349012 9:122841288-122841310 TGTTGCTGGGTAATATGCCATGG - Intergenic
1061674098 9:132205967-132205989 TGCACCTGGACAGTCTGACATGG - Intronic
1186454356 X:9699485-9699507 TCCTCCTGGACAATGCCCCAGGG - Intronic
1188244602 X:27824565-27824587 TGCTCCTAGAAAATGTGTCAAGG - Intergenic
1188351272 X:29134032-29134054 TGCTACTGAATAATATTCCATGG + Intronic
1189718559 X:43890812-43890834 TGTTCCTGGAAAATATGCAGAGG - Intergenic