ID: 946949339

View in Genome Browser
Species Human (GRCh38)
Location 2:224855797-224855819
Sequence GAGCTGAATGTTCAATTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946949339 Original CRISPR GAGCTGAATGTTCAATTTTT AGG Intronic
900468342 1:2836887-2836909 GAGCTGAATATTCCATCTTTTGG - Intergenic
901304275 1:8221364-8221386 CAGCTGATTTTTTAATTTTTTGG + Intergenic
901725484 1:11238686-11238708 TAGCTGAATTTTCCATTTTGAGG + Intronic
904621042 1:31775520-31775542 GAGCTGACTGTTAAATTCTTAGG - Intergenic
905598093 1:39226056-39226078 GAGCTGGAAGATCATTTTTTAGG - Intronic
906466929 1:46090258-46090280 GAGCTGATTGTTGTATTTTCAGG + Intronic
907543181 1:55235089-55235111 GAGCCAATTGTTAAATTTTTAGG + Intergenic
908228165 1:62077162-62077184 GAAGTGAATGTACAATTTTTAGG - Intronic
908631190 1:66109792-66109814 GAGCACAATGTTCACTATTTGGG - Intronic
909663718 1:78111163-78111185 GAGCTGCATGTTTACTTTTCTGG + Intronic
909814548 1:79975672-79975694 GAGCTGATTGTTAAATTTTCAGG - Intergenic
909884739 1:80927029-80927051 GAGTTAAATGTACAAATTTTGGG - Intergenic
910139300 1:84009050-84009072 GAGCTTTTTGTTTAATTTTTGGG + Intergenic
910792995 1:91070376-91070398 GAGCTGATTATAAAATTTTTAGG - Intergenic
910999831 1:93151525-93151547 GACCTGAATAATCAATTTCTGGG + Exonic
911061062 1:93748221-93748243 CAGCTGAATGTCCACTGTTTGGG + Intronic
911297687 1:96137390-96137412 GGGCTGAATTTTCAATTTGAGGG + Intergenic
911315146 1:96347354-96347376 AAGCAAAATTTTCAATTTTTTGG - Intergenic
913244743 1:116861652-116861674 GAACTGATTGTTAAATTTTCAGG + Intergenic
914989286 1:152484644-152484666 GAGCAGGTAGTTCAATTTTTAGG - Intergenic
915646863 1:157278781-157278803 GAGTTGAAAGTGCCATTTTTGGG + Intergenic
916246312 1:162691733-162691755 GAGCTGATTATTAAATTTTCAGG - Intronic
916615891 1:166439048-166439070 TAGCTGTATTTTGAATTTTTTGG + Intergenic
916709830 1:167394632-167394654 GAACTGAATTTTTAATTTATTGG + Intronic
917423903 1:174893337-174893359 AAGCTGAATGTTTAATTATGTGG + Intronic
917624811 1:176834949-176834971 GAGATGAATTTTCACTTTTGTGG - Intronic
918276887 1:182961400-182961422 GATGTGAATGTACAAGTTTTGGG - Intergenic
918527952 1:185485711-185485733 GATCCGGATGTTCAATCTTTTGG + Intergenic
919851087 1:201673453-201673475 GAGGTCAATTTTCATTTTTTGGG - Intronic
920140835 1:203811344-203811366 CAGCAGAATTTACAATTTTTTGG - Intronic
920277703 1:204819783-204819805 GAGCTGATTGTTAAATTTTCAGG + Intergenic
920725032 1:208427027-208427049 AGACTGAATGTTCAAGTTTTAGG + Intergenic
922019864 1:221692713-221692735 GAGCTGATTGTTAAATATTTTGG + Intergenic
922321424 1:224491381-224491403 GAACTGATTGTTAAATTTGTAGG + Intronic
923017976 1:230141636-230141658 GGGCTGAATATTCCATTTTATGG + Intronic
923106773 1:230860037-230860059 GAGCTGATTGTAAAATTTTGAGG + Intronic
923275358 1:232390619-232390641 GAGCTAAATGTTAAAATTTAGGG + Intergenic
923303838 1:232670004-232670026 GAGCTGAATGTTAAATATATTGG - Intergenic
923671403 1:236044231-236044253 GAGCTGGCTGTTAAAGTTTTAGG + Intronic
923755859 1:236790722-236790744 GAGCTGAATTTTGAATCTGTGGG - Intergenic
1065965715 10:30768883-30768905 GAGCTGATTGGTCCATTTTATGG + Intergenic
1068354141 10:55889237-55889259 GAGCTAATTGTTAAAGTTTTAGG - Intergenic
1070976081 10:80606701-80606723 GAGCTGACTGTTAAATTTTCAGG - Intronic
1072132015 10:92503430-92503452 CAGCTAAATATTCTATTTTTTGG - Intronic
1072776833 10:98205037-98205059 GACCTGATTGTTAAAATTTTAGG + Intronic
1075819555 10:125295067-125295089 AAGCTGAATGTTAAATTTTCAGG - Intergenic
1075966646 10:126617547-126617569 CAGGTGAATGTTCAGTCTTTGGG + Intronic
1076032594 10:127172246-127172268 GAGCAGAGTGTTACATTTTTAGG + Intronic
1078585681 11:12586412-12586434 GAGCTGATTGTTAAATTTTTAGG - Intergenic
1079330501 11:19529000-19529022 GTGCTGGATGTTCACTTTTTAGG - Intronic
1079761527 11:24335572-24335594 GAGGAAATTGTTCAATTTTTAGG - Intergenic
1081020059 11:37934909-37934931 GTGCTGAATTTTTTATTTTTGGG - Intergenic
1081035425 11:38138223-38138245 GATCTGTATGTTCATTTCTTTGG - Intergenic
1082099572 11:48161340-48161362 GAGTTGAATCTTGAATCTTTTGG + Intronic
1082554361 11:54542909-54542931 GAGCTGAATATTCCTTTTTATGG + Intergenic
1085669308 11:78447455-78447477 GAGGTGTATGTTCTGTTTTTAGG - Intronic
1087209809 11:95435756-95435778 GAGCTGATTGTTAAATTCTCAGG - Intergenic
1088031333 11:105254459-105254481 GACTTGAATCTTCAATTTTATGG - Intergenic
1088494905 11:110422991-110423013 GATCAGGTTGTTCAATTTTTAGG - Intergenic
1088559471 11:111097923-111097945 GAGTTGCAGGTTCAATTCTTTGG + Intergenic
1090996168 11:131867864-131867886 GAGCTGAAGGTACAGTTTTGCGG + Intronic
1091143504 11:133257078-133257100 GAGCTGATTGCTAAATATTTAGG - Intronic
1092019033 12:5185229-5185251 ATGCTGAGTGTTCAATCTTTTGG + Intergenic
1092554449 12:9541739-9541761 GAGCTCAATGATGAATTTATAGG + Intergenic
1093633110 12:21433622-21433644 GAGCTGATTGTTAAAATTTTAGG - Intergenic
1094015791 12:25862350-25862372 TATCTGAATGTTCATTTTTAAGG - Intergenic
1094396106 12:30007373-30007395 GACATGAATATTCAATGTTTTGG - Intergenic
1094517653 12:31148897-31148919 GAGCTCAATGATGAATTTATAGG - Intergenic
1095493694 12:42762415-42762437 GAGCTGACTGTTAAATTTGCAGG + Intergenic
1097923132 12:65098634-65098656 GACTTTAATGTTCAATTTTGAGG - Intronic
1099905702 12:88767114-88767136 GAGATGAATGTTCAAATCATAGG - Intergenic
1100036324 12:90256935-90256957 GAGCTGATTGTTAAATATTCAGG + Intergenic
1100256762 12:92891117-92891139 AAGCTGACTTTTCAAATTTTTGG + Intronic
1101133542 12:101714292-101714314 GAGCTGTTTGGTCAGTTTTTTGG + Intronic
1101802202 12:108032228-108032250 GAGCTAAATCTTCAACTTTCAGG + Intergenic
1105663319 13:22524048-22524070 GAGCTAATTTTTAAATTTTTTGG + Intergenic
1106277075 13:28220494-28220516 GAGCTTTATGTTCTAGTTTTTGG + Intronic
1108460280 13:50659449-50659471 GAGCTGATTGTTAAAGTTTCAGG + Intronic
1108776824 13:53775539-53775561 TAGTTGAATGTTAAATGTTTTGG - Intergenic
1109267982 13:60222505-60222527 GAGCTGACTGTTATATTTTTAGG + Intergenic
1109656356 13:65396064-65396086 GAATTGAATCTTTAATTTTTGGG + Intergenic
1109841607 13:67923489-67923511 GAAGTGAATGTTCAATTGTTAGG - Intergenic
1110689915 13:78420996-78421018 GAGCTGCATAGTCAAGTTTTTGG + Intergenic
1111032326 13:82619484-82619506 GAGGTGAGTGTTCAAGTTTCTGG - Intergenic
1111143313 13:84150523-84150545 GAAAGGAATGTTGAATTTTTTGG + Intergenic
1111204484 13:84987149-84987171 GGGCTGAATGTTGTATGTTTTGG - Intergenic
1111920908 13:94410486-94410508 GGGCTGGATGTTCAATGTTACGG - Intergenic
1114184498 14:20389969-20389991 GAGCTGATTGTTAAGTTTTCAGG + Intronic
1114706241 14:24729368-24729390 GAGCAGATTGTTCAATTTCCAGG - Intergenic
1114842600 14:26282787-26282809 GAGCTGACTGTTAAATTTTCAGG - Intergenic
1115271506 14:31558677-31558699 AATCTGATTGGTCAATTTTTTGG + Intronic
1116315731 14:43389515-43389537 CAGCTGTGTGTTCCATTTTTGGG - Intergenic
1117965247 14:61200571-61200593 GAGCTGAATGGTCAATTTTGAGG - Intronic
1118303023 14:64632174-64632196 GAGCTGGCTGTTAAATTTTCAGG - Intergenic
1119085909 14:71738661-71738683 GAACTGAATGTTTTGTTTTTTGG + Intronic
1119171760 14:72541007-72541029 GAGCTCAATGTTCAAATCTTGGG - Intronic
1120059825 14:79969365-79969387 CAGATAAATGTTCAAATTTTGGG - Intergenic
1120740885 14:88107587-88107609 GAGCTGATTGTTAAATTTTCAGG - Intergenic
1121079815 14:91098593-91098615 GAGCTGAGTGTTAAATTTTTGGG - Intronic
1125327598 15:38552773-38552795 GAGCAGATTGTTAAATTTTCAGG - Intronic
1128184230 15:65630636-65630658 GAGTTGAATGCTCAATTTTAGGG + Intronic
1128205836 15:65851353-65851375 GAACTGATTGTTAAATTTTCAGG + Intronic
1128575672 15:68772975-68772997 GAGCTGTTTCCTCAATTTTTAGG - Intergenic
1128992351 15:72271968-72271990 GAGCTCAATGTTTAAATTGTGGG + Intronic
1130612653 15:85375668-85375690 GAGCTGAATTTTTATTTCTTGGG - Intergenic
1133112740 16:3558448-3558470 AAGCTGATTGTTAAATTTTCAGG - Intronic
1134004213 16:10806999-10807021 GAGCTGATTGTTTAATTTTAAGG - Intronic
1136059354 16:27714944-27714966 AAGCTGATTCTTCAATTTATAGG + Intronic
1136416165 16:30105113-30105135 GAGCTGATTGTTAAATTCTCAGG + Intronic
1136691533 16:32034904-32034926 GACCTGAAGGATCATTTTTTTGG + Intergenic
1136792122 16:32978469-32978491 GACCTGAAGGATCATTTTTTTGG + Intergenic
1136877695 16:33875439-33875461 GACCTGAAGGATCATTTTTTTGG - Intergenic
1138706853 16:58923791-58923813 GAGCTAATTGCTAAATTTTTAGG + Intergenic
1138896493 16:61211676-61211698 GAGCTCAATGTTGAAAATTTTGG + Intergenic
1140550588 16:75861592-75861614 GAGTACAATGTTCAATATTTGGG + Intergenic
1140696009 16:77534788-77534810 GACCTGACTGTTCCATTTCTAGG - Intergenic
1141296200 16:82772111-82772133 GAGCTGGATGTTAAATTGTTAGG + Intronic
1141979953 16:87543997-87544019 GAGTGGAAGGTTCCATTTTTAGG - Intergenic
1203094329 16_KI270728v1_random:1239933-1239955 GACCTGAAGGATCACTTTTTTGG + Intergenic
1143265905 17:5637415-5637437 GAGCTGATTATTAAATTTTTAGG + Intergenic
1143867314 17:9933442-9933464 GAGCTGAATGTTAAATTTTCAGG + Intronic
1144394889 17:14834481-14834503 GAGCTGATTGGTCCATTTTATGG - Intergenic
1145822618 17:27851272-27851294 GAGCAGATTGTTCAATATTCAGG - Intronic
1145838481 17:27973204-27973226 GAGCTAATTGTTAAATTTTCAGG + Intergenic
1147449474 17:40495064-40495086 GAGCTGATTGTTAAATTTTCAGG + Intronic
1147594665 17:41709121-41709143 GAGCAGAAAATTCAATTTCTGGG - Intergenic
1147791273 17:43015659-43015681 GAGCTGACGTTTCAATTCTTTGG + Exonic
1147848951 17:43426388-43426410 GAGCTGAATGTTGAATTTTCAGG + Intergenic
1148251590 17:46085787-46085809 CAGCTAATTGTTCTATTTTTTGG + Intronic
1149271163 17:54979257-54979279 GTGCTGAATTTTCACTTTTAAGG + Intronic
1153575392 18:6514660-6514682 GAGCACTATCTTCAATTTTTTGG + Intronic
1155324174 18:24649552-24649574 GAGCCAAGTGTTCAATTTTTAGG + Intergenic
1155600933 18:27546696-27546718 GAGATGAATTTACAAGTTTTAGG + Intergenic
1155991571 18:32284157-32284179 GAAATGAATTTTCCATTTTTAGG - Intronic
1156007350 18:32458661-32458683 GAGCCCTTTGTTCAATTTTTTGG - Intronic
1157929367 18:51804150-51804172 GATATCAATGTTCAACTTTTGGG + Intergenic
1158171207 18:54602879-54602901 GAGGGGCATGTACAATTTTTGGG - Intergenic
1159177621 18:64858796-64858818 GAGATGAATGTCCAACCTTTGGG + Intergenic
1159308835 18:66681377-66681399 GTGCTGAATATTCCATTTTCTGG - Intergenic
1159546961 18:69851629-69851651 GAGCTGAATGTTCTAATTACTGG + Intronic
1159572054 18:70126721-70126743 GAGCTGATGGTTGAATTTTCAGG - Intronic
1163085750 19:14978970-14978992 GAGCTGAATGTTTAAATGTGAGG - Intronic
1166020163 19:40020773-40020795 GATCTGAATATTCTATCTTTAGG - Intergenic
1167225168 19:48233697-48233719 GAGCTGACGGTTCCATTTTCAGG + Intronic
925039954 2:724755-724777 GAGCAAAATGTTTAATTTTGAGG + Intergenic
925984249 2:9202948-9202970 GACCTGATTCTTCAATTTTCAGG - Intergenic
927583455 2:24276996-24277018 AAGCTGAATGTTCAATATCATGG + Intronic
929231210 2:39562357-39562379 GAGCTGAGTGTTCCACTGTTGGG + Intergenic
929472278 2:42206374-42206396 CAGCTGAATTTTGAATTTCTGGG + Intronic
929718704 2:44342805-44342827 GAGCTAAATGCTCAATATTTAGG + Intronic
931159269 2:59670435-59670457 GAGCTAAATGAACAATGTTTAGG - Intergenic
932217163 2:69974485-69974507 GAGCTGATTGTTAAATCTTCAGG - Intergenic
933150403 2:78908314-78908336 GTGCTGGATGTGCAATTATTGGG + Intergenic
933166850 2:79086167-79086189 GAGCTGAAGGCTGAATTTTCTGG - Intronic
934507997 2:94910991-94911013 TAGCTTAATGTTCAAATGTTGGG + Intergenic
935510982 2:103973436-103973458 GATCTTAATATTCTATTTTTAGG - Intergenic
936000139 2:108819357-108819379 GGACTGCATGTTCAATATTTTGG + Intronic
936826393 2:116586899-116586921 GAGCTGATTATTAAATTTTTAGG + Intergenic
938870864 2:135474815-135474837 AAGCTGAAAGTTCAATATCTAGG + Intronic
939779634 2:146429737-146429759 GAGCAGAAACTTAAATTTTTAGG + Intergenic
940458033 2:153926245-153926267 GAGATGAATATACAATTTATTGG + Intronic
940472912 2:154121549-154121571 CACCTAAATGTTTAATTTTTTGG + Intronic
941257489 2:163251495-163251517 GAGCTGAAATTTCAATATGTAGG - Intergenic
941462162 2:165784327-165784349 GTGCTGAATATGGAATTTTTGGG + Intronic
941632454 2:167899621-167899643 GAGCTAAATGTTCACTCGTTTGG + Intergenic
941664170 2:168227407-168227429 GATATGAATGTTGAATTTTGTGG - Intronic
942530741 2:176907188-176907210 GAGCTGATTGTTAAATTTGTAGG + Intergenic
942585332 2:177469165-177469187 GGGCTTATTTTTCAATTTTTAGG + Intronic
943547509 2:189298970-189298992 GGACTCAATGTTCAATGTTTAGG - Intergenic
943663262 2:190581831-190581853 GAGATGACTGTTAAAGTTTTAGG + Intergenic
944394719 2:199253680-199253702 TTGCTGATTGTTAAATTTTTAGG - Intergenic
946441123 2:219696909-219696931 GAGCTGATTGTCAAATTTTCAGG + Intergenic
946949339 2:224855797-224855819 GAGCTGAATGTTCAATTTTTAGG + Intronic
948081507 2:235208746-235208768 GAGCCGATTGTTAGATTTTTAGG + Intergenic
948545091 2:238722616-238722638 GAGCTGATTGGTCCATTTTACGG + Intergenic
1169519294 20:6353763-6353785 GAGCCAATTGTTAAATTTTTAGG - Intergenic
1170414308 20:16123836-16123858 GAGCTGACTGTTGAATTTTGAGG - Intergenic
1170579670 20:17688487-17688509 CAGCTGATTGTTACATTTTTAGG - Intergenic
1171781007 20:29417727-29417749 GAGCTGAATGTTCAGAATCTAGG - Intergenic
1172573626 20:35989625-35989647 GAGCTGATTGTTAAATTTTCAGG + Intronic
1172849465 20:37950246-37950268 AAGCTGAATGTTCATTATTTGGG - Intergenic
1174935792 20:54866820-54866842 GAACTGACTGTTAAATTTTCTGG - Intergenic
1175521930 20:59607400-59607422 GAGCTTCAGGTTCAATTTTCAGG - Intronic
1177179117 21:17726000-17726022 GAGATGATTGTTAAATATTTAGG + Intergenic
1177781204 21:25624154-25624176 GAGTTGAAAGTCCAATTTATTGG - Intergenic
1178483229 21:32998249-32998271 GGGCTGAATGCTCAATCTGTAGG + Intergenic
1178675725 21:34630161-34630183 GAGGTGAATAGTGAATTTTTAGG + Intergenic
1180867777 22:19129252-19129274 GAGCTGTGTGTTCAGTGTTTAGG - Intergenic
1181181315 22:21070410-21070432 CAACTGAATTTGCAATTTTTGGG + Intergenic
1181421865 22:22805897-22805919 GTGGTAAATCTTCAATTTTTTGG - Intronic
1181464430 22:23103159-23103181 GAGCTAATTTTTCAATTTTCAGG + Intronic
1181673550 22:24437330-24437352 CAGCTGGATGGTCAATGTTTGGG + Intronic
949166269 3:945197-945219 GGGCTGATTGTTAAATTTTCAGG - Intergenic
949796113 3:7852845-7852867 GAGCAGATTGTTAAATTTTGAGG + Intergenic
951651693 3:24958052-24958074 GAGCCAGATGTTAAATTTTTAGG - Intergenic
951713886 3:25617664-25617686 AAGTTGAATGATTAATTTTTTGG - Intronic
954722901 3:52581144-52581166 GATCAGAATGTTAAATTATTTGG - Intronic
955414879 3:58682944-58682966 GAGCCAATTGTTAAATTTTTGGG - Intergenic
956566661 3:70646234-70646256 GAGCAGAAGATTCTATTTTTTGG - Intergenic
956949776 3:74268739-74268761 AATATGAATGTACAATTTTTAGG + Intronic
956986509 3:74707678-74707700 GAGCTGAATGAACTTTTTTTTGG + Intergenic
957177703 3:76832990-76833012 GAGGTTAAAGTTCAATTTTAGGG + Intronic
957977219 3:87461508-87461530 CAGCTGTATGTTCATTTTGTGGG - Intergenic
958080425 3:88739603-88739625 GAGCGGAATTTTCAAAGTTTGGG - Intergenic
960231520 3:115233291-115233313 GAGCAGATTGTTAAATTTTCAGG + Intergenic
962053720 3:131846697-131846719 GAGATGACTGTTCAGTTTTCTGG + Intronic
962209343 3:133463967-133463989 GAGCTGATTTTTAAATTTTCAGG - Intronic
962562800 3:136625038-136625060 GAGTTAAATATTAAATTTTTAGG - Intronic
963865822 3:150360418-150360440 GAGCTGATTGTTACATTTTCAGG + Intergenic
964192706 3:154023468-154023490 CAGCTGATTGTTAGATTTTTAGG - Intergenic
965670636 3:171144199-171144221 CAACTGAATGTCCAATTTTAAGG - Intronic
966687053 3:182706775-182706797 CATCTAAATTTTCAATTTTTTGG + Intergenic
967568043 3:190994046-190994068 GAGCAGAAGGTTAAATATTTGGG - Intergenic
967934094 3:194712693-194712715 GACCTGAATGTCCAATATATAGG + Intergenic
970011925 4:11468817-11468839 AAGCTTCATGTTCAATCTTTTGG + Intergenic
970161302 4:13192234-13192256 GAGTTGAATGATCAATTGGTAGG + Intergenic
972185836 4:36526945-36526967 GAGCATGCTGTTCAATTTTTAGG + Intergenic
972506111 4:39721765-39721787 GAGATGCATGCTCAAGTTTTTGG - Intronic
972706804 4:41552850-41552872 GAGCTGAAAGTTCAGTTTCATGG + Intronic
975024000 4:69527053-69527075 CAGTTGAGTGTACAATTTTTAGG - Intergenic
976586321 4:86800929-86800951 GAGCTAAATGTTAACCTTTTAGG + Intronic
976698546 4:87944332-87944354 GAGCTGACTGTTAAATTTCTGGG - Intergenic
976847536 4:89507128-89507150 GAGCTGAATGTTCAACGATGAGG - Intergenic
978393887 4:108257184-108257206 GAGCTGATTGTTAAGTTTTCAGG + Intergenic
979178737 4:117698577-117698599 GAGCACAATGTTCACTATTTGGG + Intergenic
979316064 4:119264728-119264750 AAAGTGAATGTTCAATTTTGTGG - Intronic
979920822 4:126493676-126493698 GAGCAGAGTGTCCAATCTTTTGG + Intergenic
983010208 4:162537594-162537616 AAGTTGAATGTTCTGTTTTTTGG + Intergenic
983219574 4:165031650-165031672 CAGCTGATTGTTGTATTTTTTGG - Intergenic
983401351 4:167270256-167270278 AAGTTTATTGTTCAATTTTTAGG + Intergenic
984111276 4:175618258-175618280 GAACTGAATGTTAAAGATTTGGG + Intergenic
984321504 4:178202993-178203015 GACATAAATGTTCAACTTTTGGG - Intergenic
986062090 5:4201463-4201485 GAGCTGATTGGTAAATGTTTGGG + Intergenic
986769677 5:10960936-10960958 GAGCTGATTGTTAAATTTTCAGG + Intergenic
987053485 5:14167858-14167880 GAAATGAATGTTCAGTATTTAGG - Intronic
987070880 5:14335800-14335822 CAGCTAAATGTTGTATTTTTAGG - Intronic
987072904 5:14354500-14354522 GCGCTGCAGGTTCAATATTTGGG + Intronic
987137691 5:14915171-14915193 GAGCAGAATTTTCTATATTTTGG + Intergenic
987917330 5:24230948-24230970 AAGCTGATTGTTACATTTTTAGG + Intergenic
987998680 5:25319585-25319607 TAGCTAAATGTTTAATTTATGGG + Intergenic
988211222 5:28206816-28206838 GAACTGAATGTAGATTTTTTAGG - Intergenic
988354672 5:30158373-30158395 AAGGTGAATGTTCCATTTTGAGG + Intergenic
988499788 5:31775022-31775044 GAGCTGATTGTTAAAATTTCAGG - Intronic
989399736 5:40996215-40996237 CAGATAAATGTTGAATTTTTTGG - Intergenic
990006861 5:50954259-50954281 GAGCTGAATTTTGAATTTGCGGG - Intergenic
990364585 5:55057305-55057327 GAGCCAACTGTTAAATTTTTAGG - Intergenic
991041471 5:62180258-62180280 GAGCACAATGTTCACTATTTGGG + Intergenic
991654932 5:68894455-68894477 GAACTGATTGTTAAATTTTCAGG + Intergenic
992503138 5:77360938-77360960 GAACTGATTGTTTAATTTTCTGG + Intronic
992618828 5:78572633-78572655 GGTGTAAATGTTCAATTTTTAGG - Intronic
993028364 5:82672868-82672890 GAGCCGATTGTCAAATTTTTAGG - Intergenic
993148404 5:84127096-84127118 GAGCTGCGGTTTCAATTTTTCGG + Intronic
993581603 5:89668801-89668823 GAAGTGAATGTTAAAGTTTTGGG - Intergenic
994125550 5:96166371-96166393 GGGCTGACTGTTAAATTTTCAGG - Intergenic
995221437 5:109653070-109653092 GAACTGATTGTTAAATTTTCAGG + Intergenic
996373832 5:122781727-122781749 GAACTGTATGTTACATTTTTAGG + Intronic
996546923 5:124689581-124689603 GAGCTGACTGTTAAGGTTTTTGG - Intronic
997363569 5:133311147-133311169 GAGCTCATTGTTAAATTTTCAGG - Intronic
997795978 5:136811673-136811695 GTGCTCACTGTTCTATTTTTAGG - Intergenic
999610434 5:153363680-153363702 GAGCTGATTGTTACATTTCTAGG - Intergenic
1000444630 5:161304724-161304746 AAGATGAATGTTAAATTTTGGGG + Intronic
1004254940 6:14054819-14054841 GAGCTGATTGTTAAATTTTCAGG - Intergenic
1005088210 6:22028462-22028484 TAGTTGCATGGTCAATTTTTTGG + Intergenic
1005507205 6:26479924-26479946 GAGGTGATTGTTAAATTTTCAGG + Intergenic
1005935601 6:30518551-30518573 GAGCTGATTGGTCCATTTTACGG - Intergenic
1006966617 6:37992664-37992686 GGGCTGTATATTCAATTTTATGG - Intronic
1007058434 6:38912657-38912679 GAACACAATGTTAAATTTTTAGG + Intronic
1007912115 6:45526166-45526188 GATCTAAATGTACAGTTTTTTGG - Intronic
1010160783 6:72852243-72852265 GAGCTGGATGTTAAATTTTCTGG + Intronic
1010246921 6:73669599-73669621 TAGCTGGATTTTCATTTTTTAGG + Intergenic
1011013395 6:82727229-82727251 GAACTGAATCATCATTTTTTGGG - Intergenic
1011874943 6:91947637-91947659 GAGGTGTATGTTCAGGTTTTTGG - Intergenic
1012131416 6:95497902-95497924 GAGCTGATTGGTCCATTTTACGG - Intergenic
1012367351 6:98458497-98458519 GAGCTGACTATCAAATTTTTAGG - Intergenic
1012880191 6:104778146-104778168 GATCTTATTCTTCAATTTTTAGG - Intronic
1013440739 6:110164838-110164860 GCGCTGAATATTCCATTATTTGG - Intronic
1014641630 6:123917905-123917927 GAGCTAATTGTTAAAATTTTAGG + Intronic
1016039173 6:139414095-139414117 GAGCTGATAGTTGAATTTTCTGG + Intergenic
1016366663 6:143325975-143325997 GAGCTGGTTGTTAAATCTTTAGG - Intronic
1016509881 6:144830397-144830419 GAGCTGATTGTTACATTTTCAGG + Intronic
1020408267 7:7862081-7862103 CAGCTGCATGTTGGATTTTTTGG - Intronic
1021006094 7:15396735-15396757 GAGCTGATTGGTCCATTTTACGG + Intronic
1021524536 7:21572602-21572624 GAGCTAAATCTTCATTCTTTTGG - Intronic
1022158911 7:27689369-27689391 GAGCTGAGTATTAAATTTTCAGG - Intergenic
1022803306 7:33796202-33796224 GATCTGACTGTTAAATTTTCAGG + Intergenic
1023004705 7:35851086-35851108 GTGATGAATGTTTTATTTTTAGG + Intronic
1023058169 7:36306179-36306201 GAGCTGATTGTTCAAGTTTCAGG + Intergenic
1023747654 7:43336648-43336670 GAGTTCAATATTCAATATTTGGG - Intronic
1027689304 7:81322353-81322375 GAACTGATTGTTCAGTTTTCAGG + Intergenic
1029254272 7:99258655-99258677 GAGCTGATTGTGAAATTTTCAGG + Intergenic
1029872827 7:103713466-103713488 GAGATGAATGGACAAATTTTAGG + Intronic
1029900452 7:104033937-104033959 GAGCTGAATGTTAAATATCCAGG - Intergenic
1030090635 7:105854783-105854805 GAGCTGATTGTTAAATTCTCAGG + Intronic
1030906798 7:115195127-115195149 GAGCTGATTGTTAAATTTTCAGG + Intergenic
1030941770 7:115659785-115659807 GAACTGAAAGTTCTATTTTGCGG + Intergenic
1032055378 7:128680325-128680347 GATCTGAATATTCACTTCTTAGG + Intronic
1032215996 7:129957697-129957719 GATCTGTCTGTTCATTTTTTGGG + Intergenic
1032369695 7:131334574-131334596 GAGGTTTATGTACAATTTTTTGG + Intronic
1033006153 7:137566001-137566023 ATTCTGAATTTTCAATTTTTTGG + Intronic
1033320407 7:140333942-140333964 GAGGAGAATGTGCAATTTTGAGG - Exonic
1034610068 7:152358708-152358730 GAGTTAAATGTTAAATTTTAAGG + Intronic
1036099091 8:5757632-5757654 GCGCTGATTGTTCCATTTTATGG + Intergenic
1037261855 8:17018464-17018486 GAGCTGATAGTTAAATTTTCAGG + Intergenic
1038135698 8:24783299-24783321 GAGCAGTAGGATCAATTTTTTGG + Intergenic
1038294820 8:26281716-26281738 GAGATGATTGTGAAATTTTTGGG - Intergenic
1038686780 8:29726094-29726116 GAGCTGCTTGTTAAATTTTCAGG - Intergenic
1039191406 8:34980416-34980438 GAGTACAATGTTCAATATTTGGG - Intergenic
1040719447 8:50299643-50299665 AAGCTGAAATTTCAATATTTTGG - Intronic
1041454789 8:58046864-58046886 CAGTTGAATGTGCAATGTTTGGG + Intronic
1041488551 8:58406581-58406603 GAGCCTACTGTTAAATTTTTAGG - Intergenic
1042276716 8:67012584-67012606 GAGAGGAATGTGCAATTATTTGG - Intronic
1042965453 8:74347095-74347117 TAGCTGATTGTTAAATTTTCAGG - Intronic
1043507962 8:80921504-80921526 CAGCTGATTTTTTAATTTTTTGG - Intergenic
1043782434 8:84352836-84352858 GAGCTCAATGTTCAAATGCTAGG - Intronic
1044716079 8:95100952-95100974 TAGCTTAATGTTCCATTTCTTGG + Intronic
1045976873 8:108139337-108139359 GAGCTGAAAGATCAGTATTTTGG + Intergenic
1048254081 8:132892116-132892138 GACCTTTGTGTTCAATTTTTGGG - Intronic
1050019075 9:1265295-1265317 GTCCTCAATGTTTAATTTTTAGG + Intergenic
1050352310 9:4752053-4752075 GTGCTGACTGTTAAATTTTTAGG - Intergenic
1051406786 9:16746232-16746254 GAACTGACTATTAAATTTTTAGG + Intronic
1052918603 9:33944017-33944039 GAGCTGACTACTCTATTTTTGGG + Intronic
1053027736 9:34744367-34744389 GAGCTGTAAGTTCAAATTTGGGG + Intergenic
1053321656 9:37104241-37104263 GAGCTGATTGTCAAATTTTAAGG - Intergenic
1055300660 9:74878370-74878392 GAGCTGAATGTGCCAGTCTTTGG - Intronic
1055491803 9:76812847-76812869 GAGCTGACTGTTAAATTTTCAGG + Intronic
1056050625 9:82764760-82764782 GATCTGAGTGATCTATTTTTAGG + Intergenic
1056093650 9:83229199-83229221 GAGTAGAATGTTCAATATTTGGG - Intergenic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1058216611 9:102241857-102241879 GATATTAATGTTCAGTTTTTAGG - Intergenic
1058279446 9:103094175-103094197 GACCTGAATTTTCAATTAATTGG - Intergenic
1186389925 X:9148629-9148651 GAGATGAATGTTTAAATTATTGG - Intronic
1189889536 X:45584897-45584919 GAGCTGATTATTAAAGTTTTAGG + Intergenic
1190065291 X:47236817-47236839 CAGCTGGGTATTCAATTTTTTGG - Intronic
1191768576 X:64730542-64730564 GAGCAGGTTGTTCAATTTTCAGG + Intergenic
1194301466 X:92192132-92192154 GAGCTTAATGTTCTAATATTAGG + Intronic
1195022286 X:100841614-100841636 GAGAAGAATGTACAAGTTTTAGG - Intergenic
1196421658 X:115528453-115528475 CAGCTGACTGGTTAATTTTTAGG - Intergenic
1196562085 X:117161679-117161701 GAGATAAGTGTTCAATTTTGGGG + Intergenic
1198481125 X:137041930-137041952 GAGCTGATTGTTACATTTTCAGG + Intergenic
1198925255 X:141784227-141784249 TAGCTCAATTTTCAGTTTTTTGG - Intergenic
1199089843 X:143678923-143678945 GAGGTGAATGTACATTTTATTGG + Intergenic
1199179589 X:144837964-144837986 AACATGAATGTTTAATTTTTAGG - Intergenic
1199764959 X:150934824-150934846 GAGCTGCCTGTCCAATTTTCAGG - Intergenic
1201351480 Y:13047423-13047445 GAGTACAATGTTCACTTTTTGGG + Intergenic
1202242384 Y:22785192-22785214 GTGTTGATTGTTGAATTTTTTGG + Intergenic
1202395369 Y:24418941-24418963 GTGTTGATTGTTGAATTTTTTGG + Intergenic
1202475416 Y:25251151-25251173 GTGTTGATTGTTGAATTTTTTGG - Intergenic