ID: 946950971

View in Genome Browser
Species Human (GRCh38)
Location 2:224874653-224874675
Sequence CTTTGCAAAGGTAATAAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946950971_946950974 18 Left 946950971 2:224874653-224874675 CCAACTTTATTACCTTTGCAAAG 0: 1
1: 0
2: 3
3: 34
4: 286
Right 946950974 2:224874694-224874716 TCTGAAGAATCTGTTTCCTCTGG 0: 1
1: 0
2: 2
3: 21
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946950971 Original CRISPR CTTTGCAAAGGTAATAAAGT TGG (reversed) Exonic
900458902 1:2790778-2790800 CACTGCAAAGGTCATAGAGTTGG - Intronic
900502113 1:3011460-3011482 CTTTGCAGATGTAACAAGGTAGG - Intergenic
903105187 1:21072160-21072182 CTTTTCTAAGGTAATAAAGTTGG + Intronic
903984028 1:27211921-27211943 TTTTGCAAAGGTTACACAGTTGG + Intergenic
905468832 1:38176290-38176312 CTCTGCAAAGGCAAACAAGTAGG - Intergenic
905785764 1:40756156-40756178 CTTTGCAAAGCTATTGAAGTAGG - Intronic
908983719 1:69990931-69990953 TTTTACAAAGGCAATAGAGTTGG + Intronic
909425877 1:75523930-75523952 CTTCTCCAAGGGAATAAAGTAGG + Intronic
909545772 1:76844841-76844863 CTTTAAAGAGGTAATTAAGTGGG - Intergenic
912572720 1:110636360-110636382 CTGTGCAAATGTAAGAAAGGTGG - Intergenic
914198433 1:145463277-145463299 CTTAGCAAAGCTAACAAATTAGG + Intergenic
914477538 1:148036405-148036427 CTTAGCAAAGCTAACAAATTAGG + Intergenic
914511026 1:148332149-148332171 CTTAGCAAAGCTAACAAATTAGG + Intergenic
914513943 1:148357692-148357714 CTTAGCAAAGTTAACAAATTAGG + Intergenic
915401404 1:155624660-155624682 CTTTGATAAGGAAAGAAAGTAGG + Intergenic
917342864 1:173997553-173997575 CTTTACAAAGTTAATAGAGATGG - Intronic
917595369 1:176523863-176523885 ATTTGCCAAGGTACAAAAGTGGG - Intronic
920841651 1:209560520-209560542 CTCTGCCAATGTTATAAAGTGGG + Intergenic
921087302 1:211807456-211807478 CTTTGAAAAAAAAATAAAGTTGG + Intronic
921650338 1:217671093-217671115 CTTGTCATAGGTAAAAAAGTGGG - Intronic
1063617257 10:7611190-7611212 CTTTGCAAAGGTAGATAAGTTGG - Intronic
1063895225 10:10673456-10673478 CTTTGAAGAGATAATAAAATTGG - Intergenic
1066240698 10:33531767-33531789 CTTTTCAAGGGAAAAAAAGTGGG + Intergenic
1066705839 10:38176457-38176479 CTGTTCAAAGATAAGAAAGTTGG + Intergenic
1067516070 10:46945754-46945776 CGTTGCAAAGGAAACAAAGTGGG + Intronic
1067646178 10:48106056-48106078 CGTTGCAAAGGAAACAAAGTGGG - Intergenic
1068420233 10:56781589-56781611 CTTTGCCATGGTAAGAAATTTGG + Intergenic
1068568453 10:58602126-58602148 CTTTCCAAAGTAAACAAAGTAGG + Intronic
1069298283 10:66874449-66874471 CTTTGCATAGGTACTGCAGTAGG - Intronic
1070197288 10:74170212-74170234 CTTTGCAAAGCTCTAAAAGTAGG + Intronic
1071776035 10:88789147-88789169 CTTTGCATATGTGATTAAGTTGG + Intergenic
1074155527 10:110795595-110795617 CTCTGCTAAGGTAATACAGGGGG - Intronic
1074230988 10:111534999-111535021 CTTTCCCAAGGTCATAAAGCGGG - Intergenic
1074434650 10:113423959-113423981 TTTTGCAAAATTAAAAAAGTGGG - Intergenic
1075548888 10:123377580-123377602 CTTTGGCAAAGTAATAAGGTAGG - Intergenic
1076388838 10:130080723-130080745 TTTTGCAAAAGTGATAAAGGTGG - Intergenic
1077879765 11:6339777-6339799 CTTTGCAAAAGTCATAACTTAGG - Intergenic
1079082809 11:17425649-17425671 CTTTAAAAAGGTAAGAAAATAGG - Intronic
1079745183 11:24118092-24118114 CTTTTCAAAAAAAATAAAGTTGG + Intergenic
1079910211 11:26300395-26300417 CTTTGCAAATGCTATAAAATGGG - Intergenic
1080352633 11:31402813-31402835 CTTTATAAAGTTTATAAAGTAGG + Intronic
1081033040 11:38111006-38111028 CTTTGCTAAGGTAATGCAGAGGG + Intergenic
1083096468 11:60256013-60256035 CTTTGCAAAGTTTACAAATTTGG - Intergenic
1083989569 11:66238669-66238691 ATTTGCAAAGATTTTAAAGTCGG + Intronic
1085658362 11:78338579-78338601 CGTGGCCAAGGTTATAAAGTAGG + Intronic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1087380721 11:97401426-97401448 ATCTGCAAAGATGATAAAGTTGG + Intergenic
1087864873 11:103212706-103212728 CTTTGTTAGGGTAGTAAAGTAGG + Intronic
1088442831 11:109890473-109890495 AATTACAAAGCTAATAAAGTTGG + Intergenic
1090283612 11:125479936-125479958 ATTTGCAAAGGCCATAAAGGGGG - Intronic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1090750497 11:129742785-129742807 ATTTGCAAATGTCATAAACTGGG - Intergenic
1090779572 11:129995360-129995382 TTTTGCAAAGGAGAGAAAGTAGG - Intronic
1091493482 12:952526-952548 CTTTGTAGATGTAATCAAGTAGG + Intronic
1092650332 12:10627773-10627795 ATTTGGAAAAGAAATAAAGTTGG + Intronic
1092938403 12:13385519-13385541 GTTTGCAAAGGAAATCAGGTGGG + Intronic
1095200273 12:39376231-39376253 TTATGCAAAGATAATAAAGCTGG + Intronic
1095629787 12:44362131-44362153 TTTTGCAAAGGAAATAAACTAGG - Intronic
1095717426 12:45362407-45362429 CTTTGAAAAGATAACAAAATTGG - Intronic
1097411811 12:59263822-59263844 CTCTGGAAAGGTACTAAAATAGG + Intergenic
1098299215 12:69037010-69037032 ATTTCCAAAGGAAATAATGTAGG - Intergenic
1098444436 12:70551713-70551735 CTCTGCAGAAGTAATAATGTTGG + Intronic
1099449904 12:82795997-82796019 CTTTTCAGAGGTAATAAGATGGG + Intronic
1099874614 12:88389674-88389696 CTTTGCAAGAGTAAAAAAATTGG + Intergenic
1101170830 12:102091014-102091036 CTTTGCAATAGTAATAATTTTGG - Intronic
1101605474 12:106245507-106245529 CTTTTCTAAGGGAATTAAGTAGG - Intronic
1101687197 12:107036750-107036772 CTGTGCAAAGGTACTGAAGTAGG - Intronic
1102752939 12:115311555-115311577 CTTTGCAAAGAAAAAAAAATGGG + Intergenic
1103456278 12:121068700-121068722 CTTTGGAAAGGTAAGTAGGTTGG + Intergenic
1104186674 12:126439453-126439475 TTTTCCAAAGGTATTAAATTAGG + Intergenic
1107694264 13:42985192-42985214 CATTGCAATGGGAATACAGTGGG + Intronic
1107804456 13:44141365-44141387 CTCTGTAAAGGTATTTAAGTTGG + Intergenic
1109000037 13:56788818-56788840 CTTTACAAAGGTAAGAAATTAGG - Intergenic
1109138113 13:58678821-58678843 CTTTTCCAAGCTAATAATGTTGG + Intergenic
1109936607 13:69293959-69293981 ATTTGCAAAAGTGAGAAAGTAGG - Intergenic
1110247882 13:73347705-73347727 CTTGGCAAAGGAAATAAAATTGG - Intergenic
1110481335 13:75980982-75981004 CATTCCAAAGGGAAGAAAGTTGG + Intergenic
1111834062 13:93365379-93365401 CATTGAAAAAGTAAGAAAGTGGG - Intronic
1111935412 13:94552041-94552063 TTTCACAAAGTTAATAAAGTAGG - Intergenic
1112818962 13:103308763-103308785 TTCTGCAATGGAAATAAAGTGGG + Intergenic
1114081501 14:19204628-19204650 CTTGGCAAAAGTTAAAAAGTGGG - Intergenic
1115987575 14:39117845-39117867 TTTTGCAGATGTAAAAAAGTAGG - Intronic
1116832474 14:49735683-49735705 CTTTTCAAAGCCAAAAAAGTAGG - Intronic
1117064072 14:51991432-51991454 CTTTGAAAAGGTAATGAATTAGG + Exonic
1117199470 14:53373494-53373516 CTTTGCCAAGGTATTCATGTTGG - Intergenic
1117873471 14:60224725-60224747 CTTTGCAAATGTAATTAGTTAGG + Intergenic
1118115843 14:62775965-62775987 TTTAGAAGAGGTAATAAAGTTGG + Intronic
1120059918 14:79970426-79970448 CTTAGCTAAGATAATTAAGTTGG + Intergenic
1121766475 14:96490988-96491010 CTTTGAAAAAGTACTAATGTGGG - Intergenic
1122065445 14:99170259-99170281 CTTTGCAAAGTTAAAAAAAAGGG - Exonic
1123886765 15:24734387-24734409 CATAGAAAAGGTCATAAAGTTGG + Intergenic
1124988533 15:34647403-34647425 CTTTTCCAAGGTCACAAAGTTGG + Intergenic
1126309784 15:47302516-47302538 CTTTGCAGATGTGATTAAGTAGG + Intronic
1126382679 15:48065254-48065276 CTTTGCAAAGAGAATAGTGTGGG + Intergenic
1127610827 15:60634701-60634723 TTTTGAGAAGGTAAAAAAGTGGG - Intronic
1130798930 15:87240712-87240734 CTTTGCAGAGGTAATCAACTTGG + Intergenic
1131114208 15:89784210-89784232 CTTTGCCAGGCTCATAAAGTGGG - Intergenic
1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG + Intronic
1135138690 16:19903619-19903641 CTTTGCAGATGTGATTAAGTTGG + Intergenic
1138227810 16:55313258-55313280 CTTAGCAAAAAGAATAAAGTTGG - Intergenic
1140571751 16:76115344-76115366 ATATGCAAAGGAAATAAATTTGG - Intergenic
1140762868 16:78127196-78127218 CTTTGCAAAGTTGTTAAAGATGG + Intronic
1141315885 16:82962111-82962133 CTTTGCAGAGGTAATTAAGTTGG + Intronic
1141388913 16:83648099-83648121 CTTTGTAAAGGCAACAAAGCAGG + Intronic
1143228002 17:5324135-5324157 CTTAGCAAAGGTAACAAAGCTGG + Intronic
1150666219 17:67141142-67141164 CTTGGTAAAGGTAATTATGTGGG + Intronic
1150967250 17:69985527-69985549 TTTTGCAAAGGTTATAAAAGCGG + Intergenic
1151094577 17:71481645-71481667 CATTGCCAAGTTAATAAAGTAGG - Intergenic
1151142827 17:72011292-72011314 CTTTTCTAAGGTCATATAGTTGG + Intergenic
1152307250 17:79528560-79528582 CTTTGCAGATGTAATTAAGTTGG + Intergenic
1153057481 18:960907-960929 CTTTGACAAGGGAATACAGTTGG + Intergenic
1157929444 18:51805080-51805102 CTTTACAAAGGTAATAATTAAGG - Intergenic
1158381653 18:56937214-56937236 CTTTTTAAAGGTAATAAATGTGG - Intronic
1158944745 18:62438421-62438443 CTTTGCAGATGTAATTAAGGGGG + Intergenic
1159135272 18:64330108-64330130 CTTTGCACATGTAATTAATTAGG - Intergenic
1159812613 18:73034630-73034652 CTTTGCAAGGCTAATACAGGAGG - Intergenic
1163403346 19:17107819-17107841 CTTTGCAAATGCAATTAGGTAGG - Intronic
1163764672 19:19156256-19156278 CATTAAAAAGGTAATAAAGTGGG + Intronic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164223614 19:23221430-23221452 CTCTGCAAAGGTAGTAAATTTGG - Intergenic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164423815 19:28121754-28121776 GTTTACAAAGGTAAGAGAGTAGG + Intergenic
1165613276 19:37175690-37175712 ATTTGAAAATGTAATAAAATAGG + Intronic
1167726961 19:51221945-51221967 CTGTGAAAAGGCAATACAGTAGG + Intergenic
1167733759 19:51278642-51278664 CTTTGAAGAGGTAATGGAGTGGG + Intergenic
1167861832 19:52290767-52290789 CTTTACAAATGTAATAAATGTGG + Exonic
1167872553 19:52384631-52384653 CTTTACAAATGTAATAAATGTGG + Exonic
1168507761 19:56950730-56950752 CTTTACAGAGGTGATCAAGTTGG + Intergenic
925196215 2:1928268-1928290 CTGTGCAGAGGAAATGAAGTTGG + Intronic
925389966 2:3487913-3487935 CTTTGCAGATGTAATTAAATAGG - Intergenic
926765385 2:16319170-16319192 CTTTGCACAGGTAACGAAGTGGG - Intergenic
926991256 2:18682923-18682945 ATTTGCTAAGCTAATAAAGAGGG + Intergenic
927014155 2:18939212-18939234 TTTTTCAAAGATAAAAAAGTTGG - Intergenic
927582422 2:24264857-24264879 CTTTGAAAAGGGAACAAAGTTGG - Intronic
928805639 2:35149416-35149438 CTTTGCAAAGTCAAAAAAATAGG - Intergenic
929287910 2:40156311-40156333 CTTTGCCAAGATTATACAGTTGG + Intronic
929750658 2:44709310-44709332 CTTTACAAAGTAGATAAAGTAGG + Intronic
931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG + Intronic
932481348 2:72041360-72041382 CTTTGCAAAAGTAATTAGGGAGG + Intergenic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934526711 2:95056567-95056589 CTTTGCAAAGGTGAGGAACTGGG + Intergenic
936663843 2:114572204-114572226 CTTTCAAAAGATAATACAGTTGG + Intronic
936975318 2:118215049-118215071 CTTGGAAAAGAAAATAAAGTTGG + Intergenic
937017412 2:118618725-118618747 CTGTGCAAAGGTAAGAAAGGAGG - Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
939296775 2:140276405-140276427 CTTTCAAAAGGTAAGAGAGTTGG + Intronic
939914763 2:148025057-148025079 GTTTGCAAAGGTACATAAGTTGG - Intronic
940184184 2:150964313-150964335 CTATTCATAGGTAATAAAATGGG - Intergenic
940368136 2:152871566-152871588 ATTTGCCAAGATAATAAATTTGG + Intergenic
942477138 2:176339351-176339373 CTTGTCCAAGGTCATAAAGTTGG + Intergenic
943225164 2:185164184-185164206 CTTTGTAAAGCTAATAATCTAGG - Intergenic
945030527 2:205659121-205659143 TTTTTCAAAGGGAATATAGTTGG + Intergenic
945322980 2:208448130-208448152 TTTTACAAAGGGAATAAAATGGG - Intronic
946105058 2:217361869-217361891 TTTTGTTAAGGTAATAAGGTGGG - Intronic
946597329 2:221320598-221320620 CATTGTAAAGGCAACAAAGTTGG - Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
947258337 2:228191292-228191314 CTTTGCAAAGCTGAGAAACTGGG - Intergenic
1169538356 20:6571786-6571808 CTTTCCAAAAAAAATAAAGTAGG + Intergenic
1171132328 20:22665245-22665267 CATTGCAAAGGTATTAAAAACGG - Intergenic
1176313910 21:5223896-5223918 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1176912737 21:14586899-14586921 GTTTGCAAAGGTTCTAAAGCTGG + Intergenic
1177575246 21:22946235-22946257 ATTTGCAATGGTAATAAGTTAGG - Intergenic
1177660123 21:24071976-24071998 CTTTGCCAATGTAATTAAATTGG - Intergenic
1177866745 21:26521214-26521236 CTTTTAAAAGAGAATAAAGTAGG + Intronic
1177942626 21:27430031-27430053 CTGTGCAAAGGGAATAAATATGG - Intergenic
1179015623 21:37592520-37592542 CTTTGCAAATGTAATTAGTTGGG - Intergenic
1179642206 21:42755229-42755251 CTCTGCAAAGGGCAGAAAGTGGG + Intronic
1180391729 22:12290013-12290035 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1180408016 22:12574743-12574765 CTCTGCAAATAAAATAAAGTTGG + Intergenic
1180499273 22:15918058-15918080 CTTGGCAAAAGTTAAAAAGTGGG + Intergenic
1180579476 22:16817970-16817992 CTTTGGAAAAAAAATAAAGTTGG - Intronic
1180989803 22:19928704-19928726 CTTCAAAAAGGTAATTAAGTTGG + Intronic
1181508155 22:23375673-23375695 CTGTGCAAAGGTTAGGAAGTTGG - Intergenic
1183997989 22:41650399-41650421 CTTTGCAAAAACAATAAAATAGG - Intronic
1184128736 22:42504744-42504766 CTTTGCAAAGGCATGAAATTAGG - Intergenic
1184137531 22:42558059-42558081 CTTTGCAAAGGCATGAAATTAGG - Intronic
1184294857 22:43516808-43516830 CTTTGCCAAGGTCACAAAGGTGG + Intergenic
949210117 3:1488488-1488510 CTTTGTAAATGTAGTAAAATAGG - Intergenic
949724097 3:7023752-7023774 CTTTACAGAGGTAATTAAGATGG - Intronic
952026062 3:29083887-29083909 CTTGGCAAAGGAATCAAAGTTGG - Intergenic
952778788 3:37072791-37072813 CTTTGGAAAGATAAAAAAATTGG - Exonic
953640790 3:44705659-44705681 CTTTGGAGAGGTAATCAGGTGGG + Intergenic
953775528 3:45813350-45813372 CTTTGCAGATGTCATTAAGTTGG + Intergenic
954479893 3:50788895-50788917 CTTTGAAAAGATAATAAAGGGGG - Intronic
955534450 3:59908267-59908289 CTTTGCAAAGAGAATAATGAAGG + Intronic
956043205 3:65168525-65168547 CTTTGAAAAGGCACTAAACTTGG + Intergenic
956727771 3:72170537-72170559 CTGTGGAAAGGTCATAAAGGGGG + Intergenic
957329921 3:78748828-78748850 CTTTCCAAAGATAAGAAAGAAGG - Intronic
957452441 3:80397305-80397327 CTTATCAAATGTAATAATGTAGG + Intergenic
958001072 3:87749732-87749754 CTTTGTATTGATAATAAAGTTGG + Intergenic
958650057 3:96926966-96926988 CTTTGCTAGGGTAGTACAGTAGG - Intronic
959443004 3:106402550-106402572 CTTAGCAAAAGTAATAATTTTGG - Intergenic
959648070 3:108725284-108725306 CTATGCCCAGGTAATAAAGATGG - Intergenic
959737928 3:109682027-109682049 CTGTGCAAAGAAAATAAACTAGG - Intergenic
960313303 3:116143704-116143726 TTTTGAAAAGCTAATAAAATAGG - Intronic
962165950 3:133048085-133048107 CTTTGCAAAGTTAAAAAAAAGGG + Intronic
962729799 3:138270708-138270730 CTTGTCGAAGGTAATAAAATTGG + Intronic
964345641 3:155751888-155751910 TTTTGCCAAGGCAGTAAAGTGGG - Intergenic
965727866 3:171738359-171738381 CTTATCCAAGTTAATAAAGTTGG - Intronic
966979005 3:185113054-185113076 ATTTGCAATGAAAATAAAGTAGG + Intronic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
968402404 4:309410-309432 TTTTGCAAAGGAAAGAATGTGGG - Intergenic
970363611 4:15335897-15335919 CTTTGCAAGGGCAAGAAAGTAGG + Intergenic
970743248 4:19263300-19263322 CTTTGCAAATGTTATGAACTAGG - Intergenic
970804529 4:20015417-20015439 GTGTGCAAAGGAGATAAAGTAGG - Intergenic
971773036 4:30924172-30924194 CTTTGCAAAGATAATTTAGAGGG - Intronic
971795957 4:31228766-31228788 CTTTGCAAAGGTATAATAGTAGG + Intergenic
972648080 4:40989080-40989102 ATTTGCAATGTTCATAAAGTGGG + Intronic
972957538 4:44411167-44411189 CTTGGAAAAGGTACAAAAGTGGG + Intronic
974359049 4:60852322-60852344 CTAAGCAAAGGTAACAAAGCTGG + Intergenic
974359526 4:60858763-60858785 TTTTGCAATGATAATACAGTAGG + Intergenic
974709143 4:65565878-65565900 CTTTGAATAGGAAATAAACTTGG + Intronic
975127098 4:70795087-70795109 CTTTCCAAATGAAATCAAGTTGG - Intronic
975738686 4:77407128-77407150 ATTTGCAAGGTTAATGAAGTTGG + Intronic
975845402 4:78519913-78519935 CTTTGCCAAATGAATAAAGTGGG - Intronic
977173909 4:93796400-93796422 GGTTGCAAAGGAAATGAAGTTGG + Intergenic
977294797 4:95198613-95198635 CTGTGCAAAGGAACTGAAGTGGG + Intronic
977363085 4:96031449-96031471 CTTTTCCAAGGTAATACATTTGG + Intergenic
978721281 4:111912700-111912722 CTTTACAAAAGGCATAAAGTAGG - Intergenic
979063083 4:116092087-116092109 ATTTCTAAAGGTAATAAAGCTGG - Intergenic
980382857 4:132047351-132047373 ATTTGCAAAGTCAATAAAGCTGG - Intergenic
981298417 4:143159374-143159396 GTTGGCAAAGGTTATAGAGTTGG - Intergenic
981431608 4:144667827-144667849 ATTTGCAAAGGAAATATACTGGG + Intronic
981877142 4:149560196-149560218 CTTTGAAAATTTGATAAAGTAGG - Intergenic
981963500 4:150572464-150572486 TTCTGCAAAGATAATTAAGTTGG - Intronic
982841587 4:160194588-160194610 CTTTGCAAATGTTAGTAAGTAGG - Intergenic
983713961 4:170754631-170754653 CTTTGCTAAGGTAGTGAAGAAGG + Intergenic
983833588 4:172362158-172362180 CTTTGTAAAGGTATAAAAGGAGG - Intronic
983862857 4:172729675-172729697 CTGTGCAAAATTAACAAAGTTGG - Intronic
984117221 4:175696290-175696312 CTTTTCCAAGGTAAGAAAGCTGG + Intronic
984274045 4:177586586-177586608 CCTTACAACGGTAATAAAATGGG + Intergenic
984332683 4:178345648-178345670 CTTTGTAACTGTAATAATGTGGG + Intergenic
985677720 5:1240851-1240873 CTTTGCAGATGTAATTAAGTAGG + Intronic
986266111 5:6192585-6192607 CTTTTAAAAGTTAATAAATTTGG + Intergenic
986818318 5:11437235-11437257 CCTTGTAAAAGAAATAAAGTTGG + Intronic
986856687 5:11876586-11876608 CTTTGCAAGGGAAATAAAGCTGG + Intronic
990330802 5:54723531-54723553 CTTTGCAAAGGTCCAAAGGTGGG + Intergenic
990873297 5:60457018-60457040 TTTTGCAATGTTAATTAAGTTGG - Intronic
992514181 5:77474720-77474742 ATTTGCAAAGGTAAAACATTTGG + Intronic
992677363 5:79118699-79118721 CTGAGCAAAGATAATAAAGCGGG - Intronic
992900833 5:81293527-81293549 CTAAGCAAAGGGAACAAAGTTGG + Intergenic
993023596 5:82621628-82621650 TTTTGGAAAGGGAATAAAGAAGG - Intergenic
993838935 5:92852135-92852157 CTATGTAAAAGTAATAAAGTAGG + Intergenic
994211809 5:97095391-97095413 CTTTCCAAAGGAAATAATGCTGG - Intronic
995044168 5:107625149-107625171 CTATGCAGAGCTAATAAAGAAGG + Intronic
996006348 5:118425221-118425243 CTTAGCAAAAGGAATAAAGCTGG + Intergenic
996059017 5:119012174-119012196 CTGTGCACAGGTAAGAAAGGAGG - Intergenic
996960774 5:129246575-129246597 CTTTGCAGATGTAATCAAATTGG + Intergenic
997023191 5:130026307-130026329 ATTTGGAAAAGTAATAAAATGGG + Intronic
997857455 5:137384865-137384887 CTTCGCAGATGTAATTAAGTTGG - Intronic
997912350 5:137888824-137888846 CTTTGCAAAGATGAGAAGGTTGG - Intronic
999474236 5:151883780-151883802 CTTGGCCAAGGTATTTAAGTTGG - Intronic
1000135992 5:158351598-158351620 ATTTACAAAGGCAATGAAGTGGG + Intergenic
1000292140 5:159880398-159880420 CTTTTCAAAGGTGATAAAACAGG + Intergenic
1003034346 6:2630062-2630084 CTTTGCAGACATAATTAAGTTGG + Intronic
1004069576 6:12286601-12286623 CTTTGCCAAGCCAATAAATTTGG - Intergenic
1004911730 6:20292301-20292323 CTTTGAAAAGATAATAAAACTGG - Intergenic
1005008431 6:21313038-21313060 CATTGCAAATGTAATCAGGTAGG + Intergenic
1010306246 6:74326233-74326255 CTTTGGAAAGGTATTAATTTTGG + Intergenic
1011118740 6:83926575-83926597 CATTTAAAAGGTAATTAAGTTGG - Intronic
1014068963 6:117159351-117159373 CTTTGCAGATGTAATTAATTAGG - Intergenic
1014127785 6:117796263-117796285 CTATGCAAATCTAGTAAAGTTGG + Intergenic
1014533833 6:122593619-122593641 CTTTTCAAAGGCAATATAGATGG + Intronic
1015873900 6:137803365-137803387 CTTTACAAAGGTGGAAAAGTAGG - Intergenic
1015909131 6:138149025-138149047 CTTGACAAAGATAATAAAGTTGG - Intergenic
1016768387 6:147820573-147820595 CTTTACAGAGTTAATAGAGTAGG - Intergenic
1017038711 6:150290208-150290230 GTTTCCAAAGGAAATAAAATAGG - Intergenic
1020550521 7:9597668-9597690 TTTTGCAAAATTGATAAAGTTGG + Intergenic
1020679012 7:11214114-11214136 GTTTGCAAATGTTATAATGTAGG - Intergenic
1021121859 7:16804809-16804831 GTTTCCAAAGGCAATGAAGTAGG - Intronic
1022660388 7:32361447-32361469 CCTAGCAAATGTAATAAAGAAGG - Intergenic
1023716009 7:43044958-43044980 CTTTGAATTGGTAACAAAGTTGG - Intergenic
1024182713 7:46912415-46912437 ATTTCCAAAGTTAATTAAGTCGG + Intergenic
1024479726 7:49851288-49851310 TTTTGCAAATGTAATTAAGAAGG - Intronic
1025261477 7:57422482-57422504 ATTTCCAAAAGTAAAAAAGTGGG + Intergenic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1027533295 7:79363513-79363535 ATTTTCAAAATTAATAAAGTGGG + Intronic
1027921523 7:84401558-84401580 CTTGGCAAAGAGAATAAAGCTGG + Intronic
1028718042 7:93996842-93996864 CTTTCAAAATGTAATAAGGTTGG - Intronic
1028747594 7:94345690-94345712 GTCTTCAAAGGTAATAAAGTTGG + Intergenic
1030171300 7:106605598-106605620 CTGTGCAAAGGTAAAGGAGTGGG + Intergenic
1030322057 7:108179513-108179535 ATTTGAAAAGGAAATAAAATGGG - Intronic
1030642041 7:112017313-112017335 TTTTGGAAATGTTATAAAGTTGG + Intronic
1031072167 7:117173795-117173817 CCTAGCAAATGTAATAAAGAAGG - Intronic
1031907711 7:127479359-127479381 CTTTGAAGAGGAAATAAAGATGG + Intergenic
1032676062 7:134130668-134130690 CATTGCAAAGGTGCTAAACTGGG - Intronic
1033473986 7:141673088-141673110 CTCTGCAAAGGCAATGAAGTGGG + Intronic
1036988395 8:13564093-13564115 TTTTGCAAAAGTAATAATATAGG - Intergenic
1037271565 8:17136237-17136259 ATTTTTAAAGGAAATAAAGTAGG + Intergenic
1039189461 8:34956186-34956208 CTTTGCAAAGGAAACCAAATAGG - Intergenic
1039480139 8:37867044-37867066 CTTTGAAGAGGAAATAAAATGGG + Intronic
1039717761 8:40128923-40128945 CTTTCCAAAAGTTCTAAAGTTGG + Intergenic
1040876963 8:52163738-52163760 CTTTGCAAAGGTAACATAATAGG - Intronic
1042580477 8:70272470-70272492 CTTATCAAAGGAAAAAAAGTTGG - Intronic
1043414110 8:80030751-80030773 CTTTTCAAAGTTTAAAAAGTTGG - Intronic
1043576092 8:81658888-81658910 CTCTGCAAAGAAAAAAAAGTTGG + Intronic
1045143967 8:99318097-99318119 ATTTGCAAAGGCAGTAAATTAGG - Intronic
1046807281 8:118493567-118493589 CTTTGCAAATGTGATCAAGGTGG + Intronic
1054888544 9:70226157-70226179 TTTTGCAAAAGTAATGAAGGAGG - Exonic
1057098710 9:92337365-92337387 TTTTGCAAAGATAATCAATTTGG + Intronic
1057563100 9:96144307-96144329 TTTTGGAAAAGAAATAAAGTAGG + Intergenic
1058154065 9:101492511-101492533 CTTTGCACATCTAATAAATTTGG + Intronic
1058699536 9:107589149-107589171 CTTTGCAATGGAAAAAAATTAGG - Intergenic
1189628486 X:42925101-42925123 TTTTGAAAAGATAAAAAAGTTGG + Intergenic
1189642620 X:43089078-43089100 CTTTGCTAAGGTAAGAATCTTGG - Intergenic
1189810964 X:44780296-44780318 CTTTGCAAAGTTAAGCATGTTGG - Intergenic
1189887141 X:45559242-45559264 CTATGCAAAGAGAATAAAGTTGG - Intergenic
1192626233 X:72731447-72731469 CTGAGCAAAGGTAATCAAGGTGG + Intergenic
1193168559 X:78309603-78309625 CTTTGAACAGGTAATAAAAAGGG + Intronic
1194250078 X:91563398-91563420 CTCTGAAAAGGTGATAAAGTAGG - Intergenic
1194725725 X:97394426-97394448 CTTTGCTAAGGTAGGAAACTAGG - Intronic
1195461616 X:105132612-105132634 TTTTGGAAAGGAAATAGAGTGGG - Intronic
1196216673 X:113060803-113060825 CTTTGCAAAGATATTAGATTTGG - Intergenic
1196566796 X:117216353-117216375 CTGAGCAAAAATAATAAAGTTGG + Intergenic
1196942258 X:120788773-120788795 CTTTTAAAAGGGAATAATGTGGG - Intergenic
1197137523 X:123080338-123080360 GGTTGCTAAGGCAATAAAGTAGG + Intergenic
1197374720 X:125668262-125668284 CTGTGGAAAGAGAATAAAGTTGG + Intergenic
1198539628 X:137623435-137623457 CTTTTCAAAGGTGACACAGTTGG + Intergenic
1198585298 X:138114096-138114118 TTTTGCAAAGTTAAAAAAGTGGG - Intergenic
1200569040 Y:4804647-4804669 CTCTGAAAAGGTGATAAAGTAGG - Intergenic