ID: 946953141

View in Genome Browser
Species Human (GRCh38)
Location 2:224898863-224898885
Sequence GCTCAATTATCAGCCCGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946953141_946953145 19 Left 946953141 2:224898863-224898885 CCGCACCGGGCTGATAATTGAGC 0: 1
1: 0
2: 0
3: 3
4: 75
Right 946953145 2:224898905-224898927 GAAATGTTTTATCTTCATTTTGG 0: 1
1: 0
2: 6
3: 81
4: 1171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946953141 Original CRISPR GCTCAATTATCAGCCCGGTG CGG (reversed) Intronic
905413642 1:37789915-37789937 GGTCAATTATTGGCCAGGTGTGG - Intergenic
909487495 1:76189904-76189926 GCTCAATTCTTAGCCTGGTTGGG + Intronic
914446575 1:147755948-147755970 GCTCAGTTAACAGCCCCATGAGG + Intergenic
917502339 1:175597268-175597290 GCTCTATTTCCAGCCCTGTGGGG - Intronic
922300574 1:224295808-224295830 TCTCAAAAATCAGCCAGGTGTGG + Intronic
923212060 1:231812341-231812363 ATTCAAATATCAGCCAGGTGTGG - Intronic
1073448623 10:103595994-103596016 GCTAAATCATCAGCCCTGTTTGG - Exonic
1074512906 10:114134425-114134447 GCTTAGTTATCAGCAAGGTGTGG + Intronic
1082846792 11:57732808-57732830 GCTGAACTTTCAGCCTGGTGGGG + Intronic
1091774682 12:3176774-3176796 GCACGATTCTCAGCCAGGTGTGG - Intronic
1097095106 12:56540943-56540965 ACTCAAATATTAGCCAGGTGTGG + Intronic
1103605953 12:122086334-122086356 GCTCAATCTTAAGCCCGGGGTGG - Intronic
1103818613 12:123679085-123679107 GCTGAATTATCGGCCAGGCGCGG - Intronic
1104229259 12:126868342-126868364 GCTCAATCATCAGCCATCTGTGG - Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114298787 14:21355202-21355224 GGACAATTTTCAGCCGGGTGCGG + Intronic
1117396200 14:55312731-55312753 GCTCCATTTTCACCCCAGTGGGG + Intronic
1125611312 15:40972989-40973011 CCTCAATGATCGGCACGGTGGGG - Intergenic
1129967808 15:79752446-79752468 CCTCAAAAATCAGCCAGGTGTGG - Intergenic
1131717064 15:95123274-95123296 CTTCATTTATAAGCCCGGTGAGG - Intergenic
1132634525 16:936810-936832 GCTCTTTTATTAGCCAGGTGTGG + Intronic
1135480393 16:22816372-22816394 CCTCTATTATAAGCCCAGTGGGG - Intronic
1139605412 16:68014716-68014738 GATCTACTATCAGCCAGGTGGGG + Intronic
1144158559 17:12534152-12534174 GCACAAAAATCAGCCCGGCGTGG - Intergenic
1144557582 17:16295651-16295673 AATAAATTATCAGCCAGGTGTGG + Intronic
1145412609 17:22684188-22684210 GGTCAATTCTGAGCCCAGTGAGG - Intergenic
1149033256 17:52106944-52106966 GGTCAATTATGAGTACGGTGGGG + Intronic
1151069220 17:71189162-71189184 GCTGGATTATCAGCTCGTTGAGG - Intergenic
1153269796 18:3308738-3308760 GATCAATTATCACCCAGGTCAGG + Intergenic
1155846064 18:30708398-30708420 GGTCAATTAACAGCACTGTGAGG + Intergenic
1159435766 18:68414860-68414882 GCTCGATTATCATCCCTGAGGGG + Intergenic
1166683780 19:44782904-44782926 GCTCAATTCTCAGCCCTCTAGGG - Intronic
1168167039 19:54555846-54555868 GCTAAATTATCTGCCAGGAGGGG - Intergenic
926405756 2:12551101-12551123 GCTCCATTATCTACCAGGTGGGG + Intergenic
927514838 2:23666165-23666187 GCTCAAATATGAGCCCCCTGAGG - Intronic
928033827 2:27803405-27803427 TTTCAATTATTAGCCAGGTGTGG + Intronic
930892072 2:56401581-56401603 GCTCAAATATCATCTCAGTGAGG + Intergenic
933246478 2:79981030-79981052 GCTCATTTATCAGCCACGTATGG + Intronic
935723671 2:106002236-106002258 TCTCAGTTGTCAGCCAGGTGTGG - Intergenic
941190478 2:162375754-162375776 CCTCAATAATTAGCCAGGTGTGG + Intronic
941659392 2:168180054-168180076 ACACAAGTATCAGCCAGGTGCGG + Intronic
946953141 2:224898863-224898885 GCTCAATTATCAGCCCGGTGCGG - Intronic
1175808472 20:61844832-61844854 GCCCCATTCTCAGCCGGGTGTGG - Intronic
1177329918 21:19645403-19645425 GCTAAATTGTCAGCCCAGTGAGG - Intergenic
1179289582 21:40006828-40006850 GCTCAAATATCTGCCCAGTGAGG + Intergenic
1182334475 22:29574486-29574508 AGACAATTATCAGCCTGGTGCGG + Intronic
950066694 3:10117547-10117569 GCACAAAAATCAGCCAGGTGTGG - Intronic
953715197 3:45311561-45311583 GGTAAATTATCAGCCCCATGGGG - Intergenic
954187719 3:48931724-48931746 TCACAATTTTCAGCCGGGTGCGG + Intronic
960805858 3:121583318-121583340 ATGCAATTATCAGCCAGGTGTGG - Intronic
961042173 3:123685300-123685322 GATCATTTATCAGCCCAGCGTGG + Intronic
963153468 3:142071310-142071332 TATAAATAATCAGCCCGGTGCGG - Intronic
963206306 3:142639145-142639167 GCTCAGTTGTCATCCCTGTGTGG + Intronic
964764956 3:160170719-160170741 GATGAATTATCAGCTCAGTGAGG - Intergenic
971789112 4:31144412-31144434 GCTCAATTTTCAGCCGTGTTAGG - Intronic
978524774 4:109654318-109654340 GATCATATATCAGCCAGGTGTGG + Intronic
978713166 4:111809951-111809973 TATCTATTATCAGCCAGGTGCGG + Intergenic
978812708 4:112869431-112869453 CCTCAAATATTAGCCAGGTGTGG - Intronic
984231972 4:177111010-177111032 AGTCAATTATCAGCCAGGCGTGG - Intergenic
985541847 5:491080-491102 GCTGAGTTCTCAGACCGGTGAGG + Intronic
991904365 5:71494477-71494499 TTTCAAATATCAGCCAGGTGTGG - Intronic
992120074 5:73583796-73583818 GCTCAATTGCCATCCCAGTGAGG - Intergenic
992977669 5:82137875-82137897 GCTTAACTATAAGCCCAGTGAGG - Intronic
996713029 5:126562499-126562521 GCTCTATAATAAGCCAGGTGTGG - Intronic
998952835 5:147409240-147409262 ACTAAATTATAAGCCCCGTGAGG - Intronic
1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG + Intergenic
1018648058 6:165966212-165966234 GCTCCATTATGAGCCCTGTGGGG - Intronic
1025155496 7:56602466-56602488 GCATGATTATCAGCCAGGTGCGG - Intergenic
1029859362 7:103552788-103552810 GTTCTATTATCAGCCAGGCGTGG - Intronic
1032827219 7:135582748-135582770 TCTGCATTATCAGCCAGGTGTGG - Intronic
1033056676 7:138061380-138061402 CCTCAAATATTAGCCAGGTGTGG + Intronic
1033133369 7:138764488-138764510 GTTCAATTATCACCCCTTTGTGG - Intronic
1040089091 8:43378039-43378061 GCCCAATCATCAGCCTGGAGAGG - Intergenic
1060626395 9:125116352-125116374 GCTCAAATACAAGCCCTGTGAGG - Intronic
1185598285 X:1321837-1321859 CCCCAAGTATCAGCCGGGTGCGG + Intergenic
1187216009 X:17277228-17277250 TCTCAATTATAAGCTCAGTGAGG + Intergenic
1187509411 X:19904031-19904053 GCTCATTTTTCATCCGGGTGTGG - Intergenic
1189126730 X:38456087-38456109 GCTCAAATATCATCCCTGAGTGG + Intronic
1197238441 X:124095215-124095237 GGAAAATTATCAGCCGGGTGCGG - Intronic