ID: 946954998

View in Genome Browser
Species Human (GRCh38)
Location 2:224920077-224920099
Sequence TTGCTGTTGTTGTTGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6733
Summary {0: 8, 1: 211, 2: 430, 3: 1079, 4: 5005}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946954996_946954998 13 Left 946954996 2:224920041-224920063 CCAATTTGGATCTTATTATTTAC 0: 1
1: 1
2: 2
3: 29
4: 352
Right 946954998 2:224920077-224920099 TTGCTGTTGTTGTTGAGACAGGG 0: 8
1: 211
2: 430
3: 1079
4: 5005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946954998 Original CRISPR TTGCTGTTGTTGTTGAGACA GGG Intronic
Too many off-targets to display for this crispr