ID: 946954998 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:224920077-224920099 |
| Sequence | TTGCTGTTGTTGTTGAGACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6733 | |||
| Summary | {0: 8, 1: 211, 2: 430, 3: 1079, 4: 5005} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946954996_946954998 | 13 | Left | 946954996 | 2:224920041-224920063 | CCAATTTGGATCTTATTATTTAC | 0: 1 1: 1 2: 2 3: 29 4: 352 |
||
| Right | 946954998 | 2:224920077-224920099 | TTGCTGTTGTTGTTGAGACAGGG | 0: 8 1: 211 2: 430 3: 1079 4: 5005 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946954998 | Original CRISPR | TTGCTGTTGTTGTTGAGACA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||