ID: 946955072

View in Genome Browser
Species Human (GRCh38)
Location 2:224920901-224920923
Sequence TTTACTACATAGATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946955072_946955078 28 Left 946955072 2:224920901-224920923 CCCTGTTCCATCTATGTAGTAAA 0: 1
1: 0
2: 1
3: 12
4: 192
Right 946955078 2:224920952-224920974 GTGACATAATAAAATAAAGTGGG 0: 1
1: 0
2: 1
3: 40
4: 548
946955072_946955077 27 Left 946955072 2:224920901-224920923 CCCTGTTCCATCTATGTAGTAAA 0: 1
1: 0
2: 1
3: 12
4: 192
Right 946955077 2:224920951-224920973 TGTGACATAATAAAATAAAGTGG 0: 1
1: 0
2: 4
3: 57
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946955072 Original CRISPR TTTACTACATAGATGGAACA GGG (reversed) Intronic
905988022 1:42305560-42305582 TTTTCAACATGGATGGAACTGGG + Intronic
909046287 1:70714144-70714166 TTTAATACATAAATGGAATGAGG - Intergenic
909854327 1:80508869-80508891 TTTACTACAGAGATGGACTAAGG - Intergenic
912107432 1:106297496-106297518 TTTACTAAATAGAGGTAAAAAGG + Intergenic
912185713 1:107273505-107273527 TTTTTTAAATAGAAGGAACAGGG + Intronic
917417770 1:174828693-174828715 TTGACTACATAGCTACAACAAGG - Intronic
918835474 1:189459005-189459027 TTTTTGACATTGATGGAACAGGG - Intergenic
921922325 1:220683721-220683743 TTTGCTACAAACATGAAACAAGG - Intergenic
922338418 1:224636258-224636280 TTGACTACATTGATGAAAGAGGG + Intronic
922492867 1:226032488-226032510 TTGCCTACATAGATGGATGATGG + Intergenic
923022352 1:230174841-230174863 TGTACCAGACAGATGGAACAAGG - Intronic
1063573363 10:7237846-7237868 TTTGCTACTGAGATTGAACAGGG + Intronic
1063725554 10:8633805-8633827 TCTACAACATAGATGGACCTTGG + Intergenic
1064800311 10:19063178-19063200 TTTACTACAGTAATGAAACAAGG + Intronic
1066134109 10:32426125-32426147 TTGACTTCATATCTGGAACATGG - Intergenic
1068382794 10:56279736-56279758 TTTTCTTCATAGATGCAATAAGG + Intergenic
1069104281 10:64363843-64363865 TTGAGTACACAGAAGGAACAAGG + Intergenic
1069298507 10:66877286-66877308 GTTTCTAAATAGATGGATCAGGG + Intronic
1069982082 10:72259933-72259955 TTTCCTGCATAGATGGAGCAAGG - Intergenic
1072572151 10:96667858-96667880 TTTGCGCCATAGAGGGAACAGGG + Intronic
1072802830 10:98405189-98405211 TTTACTAGGTGGATGGAACCGGG + Intronic
1073786500 10:106896017-106896039 GTTAGAACATAGATGGAACTTGG + Intronic
1077437753 11:2550910-2550932 TGTACCCCATGGATGGAACACGG - Intronic
1077959229 11:7055708-7055730 TATTCTAGGTAGATGGAACATGG + Intronic
1078101892 11:8334838-8334860 GTGACTGCATAGATGGAACCTGG - Intergenic
1079197566 11:18343551-18343573 TTTACTAGATATGGGGAACAGGG + Intronic
1081372288 11:42318610-42318632 TTAATTATATAGATGAAACATGG - Intergenic
1084383830 11:68829777-68829799 TTTACTCCATAGCTGGCCCAGGG - Intronic
1085627307 11:78083311-78083333 GTCACTGCACAGATGGAACATGG - Intergenic
1087811003 11:102609151-102609173 TATACTATAAAGATGGAAGATGG - Intronic
1090348193 11:126087949-126087971 TTTACTACATATCAGAAACAGGG - Intergenic
1091192123 11:133704857-133704879 TTTTCTTCATCTATGGAACAGGG - Intergenic
1091894564 12:4090749-4090771 AATACCACATAGATGGTACAGGG + Intergenic
1093732694 12:22583884-22583906 GTTACTACATAGACAGAGCAGGG - Intergenic
1094279596 12:28720898-28720920 TTTACTACATTGGTAGAATAAGG - Intergenic
1094318090 12:29154129-29154151 TTGAGCACATAGATGGAATATGG + Intronic
1097595111 12:61620027-61620049 GTTACTACATAGCTGCAAAATGG - Intergenic
1098122158 12:67253059-67253081 TTTATTACAAAGAAGGAACCAGG - Intergenic
1098424319 12:70342262-70342284 TTAAGTACTCAGATGGAACATGG - Exonic
1099951222 12:89306587-89306609 TTTAATAGAGAGAAGGAACAGGG + Intergenic
1103148673 12:118617912-118617934 TTTACTACACAGATGTAAAGAGG - Intergenic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1104154032 12:126113497-126113519 TTTTCACCTTAGATGGAACAAGG + Intergenic
1107943249 13:45393341-45393363 TTTATTAAATAAATGAAACAAGG + Exonic
1109459784 13:62641617-62641639 TCTAGTACATAGGTGGAAGATGG - Intergenic
1109795194 13:67302370-67302392 TTTAATACATAGCTTGAATAAGG - Intergenic
1111222737 13:85225974-85225996 TTGACTACATAGAAGCAATAGGG - Intergenic
1111614474 13:90645164-90645186 TTTCCTTCATAGCTGGAAAATGG - Intergenic
1111922424 13:94426525-94426547 TATCCTACAGAGATGGAAGATGG - Intergenic
1111941985 13:94619467-94619489 GTTACTCCAAAGATGGAATAGGG + Exonic
1112374997 13:98830843-98830865 TTAAATACAGAGATGGAAAAGGG + Intronic
1112559166 13:100496642-100496664 TTTACCAGATAAATGGAAAAAGG - Intronic
1116049323 14:39783950-39783972 TTAGCTACATAGATGAAAAATGG + Intergenic
1120073446 14:80128839-80128861 GTAACAACATAGATGGAACTGGG - Intergenic
1120377819 14:83731788-83731810 GTTACTACATAGATGTAACATGG - Intergenic
1125107038 15:35984153-35984175 TTTACTACAGAGAAGTAACATGG + Intergenic
1126537014 15:49777531-49777553 TTCACTACATAGAATGAAAAGGG - Intergenic
1126562772 15:50061792-50061814 TACACTACATAAATGAAACATGG + Intronic
1126884240 15:53132590-53132612 TTTAGTGCATAGAAGAAACAAGG - Intergenic
1130513474 15:84607838-84607860 TTTATCACAGAGATGGGACAAGG - Intronic
1133454280 16:5929562-5929584 ATAACTACACATATGGAACATGG - Intergenic
1135751968 16:25065435-25065457 TTTACTCCATTGATGAAAGAGGG - Intergenic
1149075205 17:52588608-52588630 TCAACTACATGGATGGAACTGGG - Intergenic
1152206296 17:78976393-78976415 TTCACTCCATAGACAGAACAGGG + Intronic
1156833459 18:41523822-41523844 CTTATTACATGAATGGAACATGG + Intergenic
1160069800 18:75617634-75617656 TTTACTAAATAGAGTGTACATGG + Intergenic
1161886302 19:6998787-6998809 TTTATTACATATATGAAACGTGG + Intergenic
1162892675 19:13745335-13745357 TTTAGAACAGAGATGGAACCTGG + Intronic
1165736054 19:38176329-38176351 TAAACTACATAAATGGCACAGGG - Intronic
1167181116 19:47904173-47904195 TTCACTGCATAGACAGAACAGGG + Intergenic
1167183769 19:47925625-47925647 TTCACTGCATAGACAGAACAGGG + Intergenic
1167185071 19:47936026-47936048 TTCACTGCATAGACAGAACAGGG + Intergenic
1167185723 19:47941415-47941437 TTCACTGCATAGACAGAACAGGG + Intergenic
1167186390 19:47946770-47946792 TTCACTGCATAGACAGAACAGGG + Intergenic
1167187041 19:47952161-47952183 TTCACTGCATAGACAGAACAGGG + Intergenic
1167187691 19:47957544-47957566 TTCACTGCATAGACAGAACAGGG + Intergenic
1167542150 19:50096088-50096110 TTCACTGCATAGACAGAACAGGG - Intergenic
1167542585 19:50099153-50099175 TTCACTGCATAGACAGAACAGGG - Intergenic
1167543022 19:50102218-50102240 TTCACTGCATAGACAGAACAGGG - Intergenic
1167543458 19:50105281-50105303 TTCACTGCATAGACAGAACAGGG - Intergenic
1167544131 19:50110625-50110647 TTCACTGCATAGACAGAACAGGG - Intergenic
1167544806 19:50115978-50116000 TTCACTGCATAGACAGAACAGGG - Intergenic
1167545481 19:50121330-50121352 TTCACTGCATAGACAGAACAGGG - Intergenic
1167546158 19:50126685-50126707 TTCACTGCATAGACAGAACAGGG - Intergenic
1167546835 19:50132020-50132042 TTCACTGCATAGACAGAACAGGG - Intergenic
1167547493 19:50137393-50137415 TTCACTGCATAGACAGAACAGGG - Intergenic
926946161 2:18189604-18189626 TTCAATACTTAGATGGAAGAGGG - Intronic
927475425 2:23410895-23410917 TTGAGTACAGAGATGGAACTTGG + Intronic
929812991 2:45207479-45207501 TTTTCTTCAAAGATTGAACATGG + Intergenic
930963440 2:57289505-57289527 TTCACTATAAAGATGGAAAACGG + Intergenic
935167988 2:100586397-100586419 TTAAATACATAGATGGCAGATGG + Intergenic
935916979 2:107965139-107965161 TTAAGTAAATAGATGGCACATGG + Intergenic
938899141 2:135784431-135784453 TTTTCTACATAGATAGTACTAGG + Exonic
939897186 2:147806426-147806448 TCTGCTACATTGCTGGAACAGGG - Intergenic
940060207 2:149557619-149557641 TTTACCACATAAATGTAAGAGGG + Intergenic
941129524 2:161629193-161629215 TTTACTATATAGATTGACAATGG - Intronic
941665434 2:168240070-168240092 TTTGCTACATAGATGAAAAATGG + Intronic
943085807 2:183309739-183309761 TTTACTACAGATATGAAACCTGG + Intergenic
943153766 2:184147670-184147692 TTTAATACAAATATTGAACACGG - Intergenic
943829560 2:192442669-192442691 ATTATTACAGAGATGGAAAAGGG - Intergenic
945320231 2:208412797-208412819 TTTACTATATACATATAACAGGG + Intronic
946599191 2:221340628-221340650 TTTACTACAGAGGTGGGATATGG - Intergenic
946955072 2:224920901-224920923 TTTACTACATAGATGGAACAGGG - Intronic
1170346636 20:15394108-15394130 TTTACTAAATAAATGCAAGATGG + Intronic
1173023719 20:39288650-39288672 TTCACTACATAAATTGACCAAGG - Intergenic
951109638 3:18786580-18786602 TTTACTACAAAGATAAGACATGG - Intergenic
953896075 3:46803063-46803085 TTTATTAAATAAATGAAACAAGG - Intronic
958131249 3:89427101-89427123 TTAACTAGATAGATGTTACATGG + Intronic
960185502 3:114633025-114633047 TTTACTACATAGAAAGAATTAGG + Intronic
960241907 3:115353273-115353295 TTTATTACATACAGGGGACAAGG - Intergenic
960783047 3:121341708-121341730 TTTACAACATGAATGGAACTGGG + Intronic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
962615645 3:137123764-137123786 TTTACTATTTGGATGGTACAGGG - Intergenic
964975779 3:162618125-162618147 GTTACTACATGAATGGAACTGGG - Intergenic
966563930 3:181355011-181355033 TTTACTCCATATAAGGAACAAGG - Intergenic
971080020 4:23199008-23199030 CTTACTACATAGAAAGAAGAGGG + Intergenic
973997038 4:56468462-56468484 CTTACTACATACCTGGAATATGG + Intronic
974611617 4:64225744-64225766 TTTTCTCCATTGATGCAACATGG + Intergenic
974779835 4:66540379-66540401 CATACTACATTGATGGAAGATGG - Intergenic
975555130 4:75655580-75655602 TTTAATACAAAAATTGAACATGG - Intronic
975765327 4:77661573-77661595 ATTACTACTTAGATGGAATTAGG + Intergenic
976092144 4:81470355-81470377 TTTAAAACATAGTTGGACCATGG - Intronic
977493697 4:97746879-97746901 TGTTCTACATACCTGGAACATGG - Intronic
978274459 4:106932852-106932874 TTTACTTCAGAGAAGTAACATGG + Intronic
978627022 4:110697974-110697996 ATTAGTACAAACATGGAACATGG - Intergenic
981519789 4:145649477-145649499 TGTTCCACATAGATGGAAGAAGG + Intronic
982104420 4:151999229-151999251 TTTTGTACTTAGATGGGACAGGG + Intergenic
983328666 4:166294109-166294131 TTTAATTCATGGATAGAACATGG + Intergenic
984228472 4:177064670-177064692 TTTTCTCCATAGATGAGACAGGG - Intergenic
987968767 5:24913839-24913861 TTTACTTCCTGGAAGGAACAGGG - Intergenic
988154777 5:27436925-27436947 TTTTCTACATAGTTGTTACATGG - Intergenic
993165645 5:84351409-84351431 TTTCCTACATAGATGAAAACAGG - Intronic
996129203 5:119760714-119760736 TTAACTGCATAATTGGAACATGG + Intergenic
996947417 5:129087209-129087231 TTTTATACATAGATGGAACGTGG - Intergenic
998032252 5:138880669-138880691 TTACCTACATAGATGGCCCAAGG + Intronic
999058537 5:148608536-148608558 GATACAATATAGATGGAACAGGG + Intronic
1000800568 5:165720910-165720932 TTCATTACATAGATGTAAAAAGG + Intergenic
1001332836 5:170774198-170774220 TTTCCAACATGGATGGAACTGGG + Intronic
1007136619 6:39528256-39528278 GTGACAACATAGATGGAACTGGG - Intronic
1007641515 6:43343943-43343965 TTTATTACCAAGCTGGAACAAGG + Intronic
1008176816 6:48278179-48278201 TATACTACAAAGATGGATAAAGG - Intergenic
1008246441 6:49179705-49179727 TTTTCCTCATATATGGAACATGG - Intergenic
1009368668 6:62875895-62875917 TTTACTACCTAGATCGTAGAGGG + Intergenic
1010645438 6:78382217-78382239 TTTACAACATGGATGGACCTGGG + Intergenic
1010941678 6:81926449-81926471 TTTACAAAATACCTGGAACAGGG + Intergenic
1011635109 6:89364704-89364726 TTTACCAAATGGATGTAACAGGG + Exonic
1011774960 6:90719582-90719604 TTTAACTCATAGATGGAGCATGG - Intergenic
1012739091 6:102991301-102991323 TAAACAACATAGATGGAACTGGG + Intergenic
1014289592 6:119542748-119542770 TTTACTAAATAAAAGGAAAATGG + Intergenic
1014543918 6:122710328-122710350 TTCCCTACAAAGAGGGAACACGG - Intronic
1016148617 6:140707487-140707509 TGTACTACATATATTGATCATGG + Intergenic
1017087926 6:150731654-150731676 TTTACTAGAAAAATGGAAGAGGG - Intronic
1018033228 6:159860644-159860666 TTTACTTATTAGCTGGAACAGGG + Intergenic
1020416808 7:7955808-7955830 TTTACCACATAGATGTGTCATGG - Intronic
1020595634 7:10204095-10204117 TTTAATAAATGTATGGAACATGG - Intergenic
1020699713 7:11464434-11464456 TTAACTACCTAGATGGCACCTGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026773369 7:73215975-73215997 TTTAATGCATGGATGAAACAAGG - Intergenic
1027014228 7:74769371-74769393 TTTAATGCATGGATGAAACAAGG - Intergenic
1027073805 7:75176661-75176683 TTTAATGCATGGATGAAACAAGG + Intergenic
1027412807 7:77939800-77939822 TTTACTAAGTAGATGGCAAAAGG - Intronic
1028739523 7:94257621-94257643 TTTACAACCTAGATGGAGCCAGG - Intergenic
1033175082 7:139116296-139116318 TTTATTCCAGTGATGGAACACGG - Intergenic
1033603794 7:142910112-142910134 TTAATTACTTAGATGAAACATGG + Intronic
1034127079 7:148683095-148683117 TTTGCAACATGGATGGAACGTGG + Intergenic
1034177558 7:149112250-149112272 TTGATCACATGGATGGAACAAGG - Exonic
1036646763 8:10615897-10615919 ATTAATAAATAAATGGAACAGGG - Intronic
1037121257 8:15290170-15290192 TTGACTACTTGGATGTAACAAGG - Intergenic
1037522761 8:19696432-19696454 TTTAATACATAATTGGAACAGGG + Intronic
1038788431 8:30643957-30643979 TTTACTACATAGTTGTAAACAGG - Intronic
1040788619 8:51197814-51197836 TTTAGTAAATAGATGGCAGAGGG - Intergenic
1041395515 8:57386659-57386681 TTTAGTAAATAAATTGAACAAGG + Intergenic
1041404204 8:57479908-57479930 TGTGCTCTATAGATGGAACAAGG + Intergenic
1041450441 8:58000757-58000779 TTTACCACATAGTTAAAACAAGG + Intronic
1041573750 8:59369445-59369467 TTTGCTATATAAATGGGACAAGG - Intergenic
1041852531 8:62408143-62408165 TTTATTACATAAAAGGAAAATGG - Intronic
1043044532 8:75304744-75304766 TTGACTACATAGTTAAAACAGGG + Intergenic
1043679787 8:83009266-83009288 TTTATTAGATAGATGCAGCAAGG + Intergenic
1046918511 8:119702607-119702629 TTTAGTAGATAAATGGAATAAGG + Intergenic
1047096655 8:121633598-121633620 GCTATTACATAGATGGAACCAGG - Intronic
1051639797 9:19214074-19214096 TTTCTTACATATATGGCACAGGG + Intergenic
1052093847 9:24361456-24361478 TTTGTTACAAAGATGGAGCAAGG + Intergenic
1052299313 9:26935672-26935694 GTTTCTACATAGCTAGAACAGGG + Intronic
1055404942 9:75964775-75964797 TCTACTATATAGGTGTAACAAGG + Intronic
1055446720 9:76391472-76391494 TTTACTACATGGATGGTGGATGG - Intronic
1058456445 9:105142172-105142194 TTTACTCCACAGATGCAACCAGG + Intergenic
1058728089 9:107822960-107822982 TTAACTAAATAGATGTAAAACGG - Intergenic
1059117787 9:111615074-111615096 TTTGTTACATAGATGGGAGATGG + Intergenic
1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG + Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186024637 X:5295952-5295974 TTTCCTACAGAGAGGAAACATGG + Intergenic
1186215562 X:7296623-7296645 TTTCCTGCATAGATGGGAAAAGG - Intronic
1186707348 X:12155735-12155757 TTTAGGAAATACATGGAACATGG - Intronic
1188842459 X:35033088-35033110 TTTTCTAAATAGATTGAAAATGG + Intergenic
1192307246 X:69974735-69974757 TTTAATACAAACATAGAACAAGG + Intronic
1193132078 X:77930877-77930899 TTTTCTACATAGGTGGTACATGG + Intronic
1193711666 X:84887566-84887588 TTTACTTCATAGATTGGACATGG - Intergenic
1194225139 X:91246984-91247006 TCAACAACATAGATGGAACTGGG - Intergenic
1194268825 X:91784474-91784496 TTTACTCGATAGATGGAAGATGG - Intronic
1194299684 X:92170486-92170508 TTTTCTCCATACCTGGAACAAGG - Intronic
1197152815 X:123238581-123238603 TTTACTACAAAGATGCACCTTGG + Intronic
1198657985 X:138935422-138935444 TTAACAACAGAGATGGTACAAGG + Intronic
1200462647 Y:3476594-3476616 CTTATTAAATAAATGGAACAGGG - Intergenic
1200561607 Y:4710291-4710313 TCAACAACATAGATGGAACTAGG - Intergenic
1200586036 Y:5005486-5005508 TTTACTGGATAGATGGAAGATGG - Intronic
1200617328 Y:5395647-5395669 TTTTCTCCATACCTGGAACAAGG - Intronic