ID: 946960500

View in Genome Browser
Species Human (GRCh38)
Location 2:224979925-224979947
Sequence TGGAGCCAGAACACCTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946960500_946960503 23 Left 946960500 2:224979925-224979947 CCAACCTAGGTGTTCTGGCTCCA 0: 1
1: 0
2: 2
3: 20
4: 168
Right 946960503 2:224979971-224979993 AAAAATCAATATACAATACTTGG 0: 1
1: 1
2: 7
3: 76
4: 728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946960500 Original CRISPR TGGAGCCAGAACACCTAGGT TGG (reversed) Intronic
900950590 1:5856256-5856278 TGGAGGCAGAACCTCTAGGTGGG - Intergenic
901703302 1:11056805-11056827 TGGAGCCAGCACAGCCACGTGGG + Intronic
902427824 1:16338526-16338548 TAGAGTCAGAACAGTTAGGTAGG - Intronic
908380380 1:63592712-63592734 TGGAGCCAGACCACCTGAATTGG + Intronic
910832454 1:91474509-91474531 TGAAGCCAGAAAACCTGGGCTGG + Intergenic
916372405 1:164113886-164113908 TGGAGCCAGACCCCTTGGGTTGG - Intergenic
917294085 1:173501167-173501189 TGGAACCAGAAAACTTATGTAGG + Intronic
923266643 1:232320833-232320855 TGGAGACAGAAGACCATGGTGGG - Intergenic
923722899 1:236482488-236482510 CGGAGCAAGAACTCCAAGGTGGG - Exonic
923848258 1:237762288-237762310 TGGGTCCAGAAAACCTAAGTCGG - Intronic
1067685161 10:48462513-48462535 TGGAGCCAGACTGCCTGGGTTGG - Intronic
1067981295 10:51088567-51088589 TGGACCCAGCATTCCTAGGTTGG + Intronic
1071812984 10:89203902-89203924 TGCAGCCAGATTACCTGGGTGGG - Intergenic
1076851368 10:133095072-133095094 AGTAGCCAGAACACCAAGGAGGG + Intronic
1079100373 11:17537919-17537941 TGGAGCCAGTAGGCATAGGTTGG - Intronic
1085201461 11:74704708-74704730 TGGAGCCAGAACAGCAAGACAGG + Intronic
1086595635 11:88567454-88567476 TGGAGTGACAACTCCTAGGTTGG + Exonic
1087531883 11:99393319-99393341 TGGAGACAGAACCAGTAGGTTGG + Intronic
1089000505 11:115048080-115048102 TAGAGCCAGATTACCTAGGCTGG + Intergenic
1089629658 11:119776430-119776452 TGGAGCCAGATCTCCCAGATTGG + Intergenic
1089636979 11:119821048-119821070 TGGAGCCAGACCCCCAGGGTTGG + Intergenic
1091093412 11:132793825-132793847 TGAAGCCAGGACACTTAGGTAGG - Intronic
1091813109 12:3416122-3416144 TGGAGCGAGGAGACCTAGGCAGG - Intronic
1094272138 12:28628744-28628766 CAGAGCCAGAATGCCTAGGTTGG - Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1096196495 12:49652012-49652034 TGGAGCCAGAAGGTCCAGGTCGG + Exonic
1096624649 12:52887045-52887067 AGGGGGCAGAAGACCTAGGTGGG - Intergenic
1096985125 12:55751088-55751110 TAGAGCCAGCAGACCAAGGTGGG + Exonic
1097688308 12:62711372-62711394 TGGAGCCAGACTGCCTAGCTGGG - Intronic
1099886532 12:88537915-88537937 TGGAGACAGACCACTCAGGTTGG + Intronic
1100923278 12:99514631-99514653 TGGTGCCAGAAGACCAAGGTTGG - Intronic
1101434984 12:104656855-104656877 TGTAGCCTTAACACCTAGATGGG - Intronic
1102767313 12:115444873-115444895 AGGAGCCACAACACCTAGCCTGG - Intergenic
1103795730 12:123501845-123501867 GGCAGGCAGATCACCTAGGTCGG + Intronic
1105292304 13:19060858-19060880 TGGAGCCAGGACACCTCAGGAGG - Intergenic
1107149126 13:37091475-37091497 AGGAGCCAGAACTTCAAGGTGGG + Intergenic
1111080556 13:83301571-83301593 TGGAGCCAGAAAACCAAGATAGG - Intergenic
1112897740 13:104321356-104321378 TGAAGGCAGAACACATAGCTTGG + Intergenic
1112975575 13:105313684-105313706 ATCAGCCAGAACACCTACGTAGG + Intergenic
1114112839 14:19488687-19488709 TGGAGCCACATCACCCAGATGGG - Intergenic
1116122887 14:40743079-40743101 AGGAGCTAGAAAACCTAGGTAGG + Intergenic
1118324455 14:64771834-64771856 TGGGGACAGAACACCAGGGTTGG - Intronic
1118827290 14:69395503-69395525 TGGAGACAGAAAACCTAAGCAGG - Intronic
1118919620 14:70138177-70138199 TGGAGCCAGCAGCCCTAGGATGG + Intronic
1119567560 14:75641462-75641484 TGGAGCCAGAAGACTCATGTTGG + Intronic
1120647312 14:87089440-87089462 TGGAGCCAGAATACCTGGGTTGG - Intergenic
1122405670 14:101499355-101499377 AGGAGCCAGCAGACCTGGGTTGG + Intergenic
1122694849 14:103547529-103547551 TGGAGCAAGGACCCCCAGGTTGG - Intergenic
1126466495 15:48965528-48965550 GGGAGCCAGCTCATCTAGGTAGG + Intergenic
1126518223 15:49558587-49558609 GGCAGGCAGAACACTTAGGTGGG - Intronic
1129101684 15:73270781-73270803 TGGAGCCTGAACACTTTGCTGGG + Intronic
1129554570 15:76493026-76493048 TGAAGCCAGAACACTTAGAGTGG + Intronic
1129684829 15:77679672-77679694 TGGAGTCAGAACACCTGACTAGG + Intronic
1133030339 16:3007874-3007896 TGGAGCTAGCCCCCCTAGGTGGG - Intergenic
1136173068 16:28499787-28499809 TGGGGCCAGGACACCTGGGCCGG + Exonic
1136559258 16:31029249-31029271 GGGAGCCAGATGACCTGGGTTGG - Intergenic
1137320609 16:47377741-47377763 TGAAGCCAGAATACCATGGTAGG - Intronic
1138136773 16:54530217-54530239 TGGAGCCAGAATTCCAAGCTTGG + Intergenic
1138336028 16:56253323-56253345 TGGAGTCAGAAGACCTGGGTTGG + Intronic
1139245447 16:65437438-65437460 TGGACCCAGGACATCTATGTGGG - Intergenic
1139316118 16:66070522-66070544 TCGAGCCAGAGCACCCAGCTAGG - Intergenic
1140279552 16:73542247-73542269 TGGAACCAGAACATTTGGGTGGG + Intergenic
1142242099 16:88952255-88952277 TGGAGCCAGGACACCCGGGGAGG + Intronic
1143432104 17:6894860-6894882 TGGAGGAAGAACACACAGGTAGG - Intronic
1145936125 17:28715928-28715950 TGGAGCCAGCCCACCTGGCTAGG + Intronic
1147427210 17:40351569-40351591 AGGAGGCAGAGCACCTAGGAGGG + Intronic
1149316416 17:55443051-55443073 TGAAGTCAGAAAACCAAGGTTGG - Intergenic
1151361823 17:73593540-73593562 CAGAGGCAGAACACCTAGCTTGG + Intronic
1152005583 17:77678317-77678339 TGGTGCCAGCAGACCTGGGTTGG + Intergenic
1156059712 18:33059223-33059245 TGGAGGCAGAACATCTATTTAGG + Intronic
1159451869 18:68612624-68612646 TGAAGCCAGAAGACCTATTTTGG + Intergenic
1160441300 18:78894755-78894777 AGGAGACAGAACATCTGGGTTGG - Intergenic
1162721295 19:12664531-12664553 TGGGGCCAGAACACCAAGAGGGG + Intronic
1163690765 19:18737055-18737077 TGGAGCAGGAGCCCCTAGGTAGG - Intronic
1166008710 19:39925586-39925608 TGGAGTCAGGCCGCCTAGGTAGG + Intronic
1168034854 19:53711240-53711262 TGAATCCAAAAGACCTAGGTTGG - Intergenic
927228171 2:20791231-20791253 TGAAGCCAGACTACCTGGGTTGG + Intronic
928896473 2:36270860-36270882 TGGAACAGGAACTCCTAGGTTGG - Intergenic
930636490 2:53811731-53811753 TGGAGCCAGACTGCCTCGGTTGG - Intronic
933322961 2:80800089-80800111 AGGAGTCAGAAGACCTGGGTTGG - Intergenic
937843204 2:126547781-126547803 TGGAGCCAGAATTCTAAGGTAGG - Intergenic
938427081 2:131201575-131201597 TGGAGCCACATCACCCAGATGGG + Intronic
938468027 2:131535621-131535643 TGGAGCCACATCACCCAGATGGG + Intergenic
938721666 2:134072546-134072568 TGGACCCAGAACAACTTGGCAGG + Intergenic
939863556 2:147446662-147446684 TGGAGGCAGAAAACCTAAGGTGG - Intergenic
941465686 2:165823659-165823681 TGCAGACAGAACTTCTAGGTGGG + Intergenic
946960500 2:224979925-224979947 TGGAGCCAGAACACCTAGGTTGG - Intronic
948556200 2:238813197-238813219 TGGACCATGGACACCTAGGTGGG - Intergenic
1168832860 20:856502-856524 TGGAGCCACAAAACCAAGCTGGG - Intronic
1168842499 20:918426-918448 TGGAGCCAGCACATCTGGATCGG + Intergenic
1170761094 20:19252261-19252283 TGCAGCCAGAATAACTAGCTTGG + Intronic
1172804063 20:37598541-37598563 TGGAGCCTGAACTCCTGGGGAGG + Intergenic
1173897310 20:46560853-46560875 GGCAGCCAGAAGACCCAGGTGGG - Intronic
1174580633 20:51569109-51569131 AGGAGCAGGAACACCAAGGTGGG - Intergenic
1179231840 21:39510998-39511020 TGGAGACTGTACACTTAGGTGGG + Intronic
1180055788 21:45358572-45358594 TCGAGCCAGAGCCCCCAGGTAGG + Intergenic
1181108054 22:20586220-20586242 TGGAGCCACAGCACCCAGATTGG - Intronic
1181168636 22:20996199-20996221 TGGGCCCAGATCACCTAGCTGGG - Intronic
949645089 3:6084147-6084169 TGCAGCCAGCTCACCTAGATAGG + Intergenic
949953679 3:9250105-9250127 TGGAGGCAGAACAGCTGGGTGGG + Intronic
950541016 3:13613021-13613043 TGGAGCTAGATGACCTAGGATGG + Intronic
955287033 3:57651950-57651972 TGTAACCCCAACACCTAGGTGGG + Intronic
955321121 3:57975129-57975151 TGGAGCCAGAAAACCAAATTGGG + Intergenic
955344098 3:58148389-58148411 TGGAGCCAGGACATCTTGGGTGG + Intronic
959685020 3:109135625-109135647 TGGAGGCATAACTCCCAGGTAGG + Intergenic
962224674 3:133596069-133596091 TGGAGCCAAAACACCTGGGTTGG - Intergenic
962391205 3:134974302-134974324 TGGAGCCAGACTGCCTGGGTTGG + Intronic
964091660 3:152884412-152884434 TGGATCCAGAATACATAGTTTGG - Intergenic
964308482 3:155365714-155365736 AGGACCCAGAACAGCTAGGGAGG + Intergenic
965503880 3:169489664-169489686 TAGAGCCAGAACACTTGGTTAGG + Intronic
966680551 3:182637783-182637805 TGGGGCCAGTAGAGCTAGGTGGG - Intergenic
968627016 4:1630296-1630318 GGGGGCCACAACACCAAGGTGGG - Intronic
969273653 4:6119881-6119903 TGGAGGCAGGAGACCTGGGTTGG - Intronic
970965757 4:21925887-21925909 TGGAGCTGGAAGACCTAGGTTGG + Intronic
971366943 4:25985078-25985100 GGGAGCCAGAACACTTGGTTTGG - Intergenic
973538215 4:51906106-51906128 TGGAGGCAGAACACTCAAGTGGG + Intronic
974394825 4:61321285-61321307 TGGAGTCAGATCACCTAAGTTGG + Intronic
975112785 4:70645549-70645571 GGGAGACAGAACAGATAGGTTGG - Exonic
977939854 4:102846542-102846564 TGGAGAGAGAAAACCTATGTAGG - Intronic
978389644 4:108212006-108212028 TGGAGGCTGAAGACCAAGGTGGG - Intergenic
978582751 4:110248453-110248475 TGGAGTCAAAACCCCTAGATAGG - Intergenic
978809343 4:112832984-112833006 TGGAGCTAGTACAAGTAGGTTGG + Intronic
980759567 4:137212570-137212592 TGGAGCGAGACCACTTAGGTGGG - Intergenic
981118505 4:141020513-141020535 TAGAGCCAGAACACTTAGGAAGG - Intronic
983368429 4:166826507-166826529 TGGAGTCAGAACAACTAGTTTGG - Intronic
983680734 4:170350717-170350739 TGGAGCCAGACTGCCTAGTTTGG + Intergenic
984209390 4:176826738-176826760 TGGAGCTAGAACAGCTATATTGG - Intergenic
986482348 5:8202229-8202251 TGGACCCAGAACACCCGGGTTGG - Intergenic
987239602 5:15981588-15981610 TGGAGAAAGAACAACCAGGTTGG + Intergenic
989168789 5:38455262-38455284 GTGAGCCAGAGCACCAAGGTGGG - Intronic
990463844 5:56053743-56053765 TGGAGGCAGACCACACAGGTAGG - Intergenic
991602062 5:68362485-68362507 GGAAGCCAGAAAACCTAGGATGG + Intergenic
994732372 5:103507823-103507845 TGGAGCCAGAACAGTGAGGTTGG + Intergenic
997590818 5:135071125-135071147 TGGAGCCACAACACCTATCCTGG - Intronic
999492380 5:152063901-152063923 AGGAGACTGAAGACCTAGGTGGG + Intergenic
1000242593 5:159422526-159422548 TGGAGCTTGAACAACTAGGTCGG + Intergenic
1001253072 5:170163345-170163367 TGGAGCCAGATGGCCTTGGTCGG - Intergenic
1005229106 6:23679677-23679699 TGAAGCCAGAGAACCTAGTTTGG - Intergenic
1005818443 6:29576793-29576815 TGGAGCCCAAACTCCTAGATCGG + Intronic
1006788435 6:36683309-36683331 TGGAGCCAGATCACCTGGGCTGG - Intronic
1007395847 6:41577368-41577390 TGGAGCCAGAGCACACAGTTGGG - Intronic
1008071779 6:47105585-47105607 TGGAGCCAGTACACCAGGGCTGG - Intergenic
1010725876 6:79332484-79332506 TGGAGGAAGACCACCAAGGTTGG - Intergenic
1011518836 6:88182268-88182290 TGGAGACAGAAGCCCAAGGTGGG - Intergenic
1011759233 6:90542601-90542623 TGGAGTCAGAAGATCTGGGTTGG + Intronic
1013851933 6:114526720-114526742 TGGAGCCAGATCACAAAGGCGGG - Intergenic
1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG + Intronic
1015506156 6:133991106-133991128 TAGTGCCAGAACACTTAGGAGGG - Exonic
1016373514 6:143397728-143397750 TGGGGCCTGAACATCTAGATTGG + Intergenic
1017484314 6:154889010-154889032 GGGAACCAGAACATCCAGGTTGG + Intronic
1018943090 6:168323075-168323097 TGTAGCCAGAACAACTTGGCAGG - Intergenic
1019951690 7:4378335-4378357 TGGAGCCAGACCACCCAGCCAGG - Intergenic
1022232008 7:28423424-28423446 TGGAGACAGAAAACCCAGTTAGG + Intronic
1022329358 7:29362816-29362838 TGGAGACACAAAACCAAGGTGGG - Intronic
1023810505 7:43907600-43907622 TGAAGCCAGAATACCTGTGTTGG + Intronic
1024598851 7:50962349-50962371 GTGAGCCAGAACACCAAGGCAGG + Intergenic
1024953959 7:54896482-54896504 TGGAGTCAGATCACATGGGTTGG - Intergenic
1025781739 7:64608166-64608188 TAGAGTCACATCACCTAGGTTGG - Intergenic
1027045390 7:74987736-74987758 TCGAGACAGAGCACCTAGGCTGG + Intronic
1027794100 7:82670533-82670555 TGAAGCCAGAATATGTAGGTTGG + Intergenic
1028091730 7:86710954-86710976 TGGAGCCAGACAACCTGGATAGG - Intronic
1028933079 7:96435927-96435949 TGGAGCCAGACAGCCTTGGTTGG - Intergenic
1036396693 8:8376871-8376893 GTGAGCCAGAACTCCGAGGTAGG - Exonic
1036592875 8:10184822-10184844 TGGAGTGGGAAGACCTAGGTAGG - Intronic
1038144590 8:24883492-24883514 TGGAGTCAGAAGACCTGGGCTGG - Intergenic
1039059595 8:33563139-33563161 TGGAGTCAGCAAACCTAGGAGGG - Intronic
1044925852 8:97208211-97208233 TGGTGCCAACACACGTAGGTGGG + Intergenic
1045217401 8:100162026-100162048 TGGTCCAGGAACACCTAGGTGGG + Intronic
1045298937 8:100894198-100894220 TGGAGTCAGAAGACTTGGGTTGG - Intergenic
1045553031 8:103189680-103189702 TGGAGAAATAACACCTAGGTGGG + Intronic
1047099778 8:121664230-121664252 TGGAATCAGAATGCCTAGGTTGG - Intergenic
1051782479 9:20704980-20705002 TGGAGCGAGACTACTTAGGTTGG + Intronic
1053016354 9:34664522-34664544 GGGAGCAAGAACTTCTAGGTAGG + Exonic
1053837598 9:42157422-42157444 GGTGGCCAGAACACCTATGTGGG - Intergenic
1053883431 9:42618737-42618759 GGTGGCCAGAACACCTATGTGGG + Intergenic
1053889238 9:42675562-42675584 GGTGGCCAGAACACCTATGTGGG - Intergenic
1054222453 9:62426204-62426226 GGTGGCCAGAACACCTATGTGGG + Intergenic
1054228259 9:62482968-62482990 GGTGGCCAGAACACCTATGTGGG - Intergenic
1055711966 9:79073334-79073356 TGGAGACAGACTACCCAGGTTGG + Intergenic
1056689131 9:88791336-88791358 TGGACCCAGAAGGCCCAGGTGGG - Intergenic
1056773388 9:89495735-89495757 TGGAGCCAGAGCTCCAGGGTTGG - Intronic
1060143168 9:121227868-121227890 TGGAGCCAGAATTCCTAAGCTGG - Intronic
1187289379 X:17938272-17938294 TGGAACCAGAAGACCTGGGTAGG + Intergenic
1187569525 X:20486893-20486915 TGGAGGCAGAAAACCAAGGTGGG + Intergenic
1187993820 X:24904509-24904531 AGGAGCCAGAACTCCAAGGAAGG + Intronic
1189057846 X:37717296-37717318 TGGAGCAAGACTACTTAGGTTGG + Intronic
1195140751 X:101957013-101957035 TGGAGCCAGGAGTCCTAGGCAGG + Intergenic
1195681547 X:107550906-107550928 TCTACCCAGAAAACCTAGGTTGG + Intronic
1196703506 X:118696860-118696882 AGCAGCCAAAACACCCAGGTAGG - Intergenic
1196969720 X:121095614-121095636 AGGAGGCAGAAGACCTTGGTTGG + Intergenic
1199876174 X:151930050-151930072 TGGAGGCAGGAGGCCTAGGTGGG + Intergenic