ID: 946961776

View in Genome Browser
Species Human (GRCh38)
Location 2:224993061-224993083
Sequence ACTGAAAATCAGGCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946961776 Original CRISPR ACTGAAAATCAGGCAGTGGA AGG Intronic
900411755 1:2515717-2515739 ACTGGAAGACAGGCAGTGGCAGG + Exonic
901456091 1:9363643-9363665 ACTCAAAATAAGGCACTGGATGG + Intronic
901646898 1:10721707-10721729 CCTGCAAACCAGGAAGTGGACGG + Intronic
902637422 1:17743668-17743690 ACTGAAGATAAGCCAGTGCATGG - Intergenic
903784451 1:25848924-25848946 AATGAAAATCAGCCAATGGCAGG - Intronic
905056616 1:35100179-35100201 ACTAAAAATCAGGCAGGGCGTGG - Intronic
906348767 1:45038985-45039007 AGTGAGAAACAGGCAGTCGATGG + Exonic
907517813 1:55004382-55004404 AGTGAGAATCTGGCAGAGGAGGG + Intronic
914393270 1:147241061-147241083 AATAAAAATCAGGTAGTGAAGGG - Intronic
914661436 1:149793489-149793511 ACTGACAATGAGGCCCTGGAGGG + Intronic
917108712 1:171522477-171522499 ACTGAAAACCAGGCCGGGGACGG + Intronic
918374306 1:183893533-183893555 AGTGAAAATCAGGTAGAGGTGGG + Intronic
919932421 1:202229964-202229986 TCTGAAAAGCAAGCAATGGAAGG - Intronic
922067596 1:222158931-222158953 AGTGAAAGTCAGACAGTGAAAGG + Intergenic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
1062767634 10:77496-77518 ATAGAAAGTCAGGCAGTGCATGG - Intergenic
1062958660 10:1557097-1557119 CCTGAAACTGAGGCAATGGAAGG - Intronic
1063038071 10:2308427-2308449 ACTGGACATCAGGCAGTGAGGGG + Intergenic
1063308756 10:4932983-4933005 ACTGAAAATCAGGTGATGTAAGG - Intronic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1064814669 10:19245971-19245993 ACTTAAATGCAGTCAGTGGAAGG + Intronic
1065746337 10:28845852-28845874 AATGAAAAACAGCCAGTGGCTGG + Intergenic
1067007211 10:42675471-42675493 AGTGCAAATCAGCCAGTAGATGG - Intergenic
1067199927 10:44159109-44159131 ACAGAAAATCAGTCAGTGTAGGG + Intergenic
1067795789 10:49320656-49320678 ACTGAACTTCAGGCACTGTATGG + Intronic
1068590392 10:58846940-58846962 ACTGAGAGTCAGGAAGTGGAAGG + Intergenic
1070095770 10:73337188-73337210 AATGAAAAACAGGCAGGGCATGG + Intronic
1070500409 10:77067268-77067290 ACTGACCATCAGGCAGAGGGAGG - Intronic
1070751067 10:78964176-78964198 ACTGACCAGCAGGCAGTGAAGGG - Intergenic
1070765903 10:79056275-79056297 ACTGAGACCCAGGCAGGGGAAGG - Intergenic
1072877535 10:99189154-99189176 ACTGAAAAACTTGCATTGGATGG - Intronic
1073001970 10:100292587-100292609 ACTGGGAATCAGGGAGTGAATGG + Intronic
1077180386 11:1209723-1209745 ACTGAAGAGCTGGCAGTGGTGGG - Intergenic
1077511472 11:2966534-2966556 ACGGAAAATCAGGCACAGAAAGG - Intronic
1077893931 11:6439957-6439979 ACTGAAGAACAGCCACTGGATGG + Intronic
1078199833 11:9170969-9170991 ACTGGACATCAGGCAATGAAGGG + Intronic
1078417528 11:11178091-11178113 AATGAAAATGAGGAAGAGGATGG - Intergenic
1078933235 11:15929349-15929371 TCTAAACATCAGGCAGTGCATGG + Intergenic
1079001611 11:16762205-16762227 AGTGAAAATCAGGCATTATAGGG + Intergenic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1079588682 11:22156103-22156125 AGTGAAATGAAGGCAGTGGAAGG + Intergenic
1079668102 11:23133680-23133702 ACTGAAAAATAGCCAGTGCAGGG - Intergenic
1079732646 11:23954375-23954397 AGTGAAAAACAGACAGTAGATGG - Intergenic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1083930880 11:65844210-65844232 ACTGGAAATCAGATAGTGCAAGG - Intronic
1084379748 11:68804283-68804305 ACAGAAAATCAGTAAGTGGTTGG - Intronic
1084784605 11:71434896-71434918 ACTGCAGAGCAGGCAGGGGAGGG + Exonic
1086236222 11:84634193-84634215 ACTGAGAATCAGGGAGATGAAGG - Intronic
1086253634 11:84848037-84848059 AGTGAAAATGAGTCAGAGGATGG + Intronic
1086453837 11:86942583-86942605 GATGAAAATCAGGCAGTGGATGG + Intronic
1087375255 11:97331783-97331805 ACTGAAAATATAGAAGTGGAGGG - Intergenic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1088489525 11:110373094-110373116 ACTGCAATTCATGCAGTGGGTGG + Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1091995152 12:4987456-4987478 AATGAAAGTCAGCTAGTGGAGGG - Intergenic
1092095542 12:5839067-5839089 ACTGGACATCAGGCAATGAAAGG + Intronic
1092444255 12:8538977-8538999 ACAGTAAATCTGGAAGTGGAAGG - Intronic
1092625288 12:10320293-10320315 GCTTGAAAACAGGCAGTGGATGG + Intergenic
1094295174 12:28897702-28897724 ACTGAGTATCAGGCAGAGGTTGG + Intergenic
1094590047 12:31811470-31811492 ATTGAAAAACAGCCACTGGATGG - Intergenic
1095761301 12:45840099-45840121 ACTCATAATGAGCCAGTGGAAGG - Intronic
1096419576 12:51445524-51445546 ACAGAAAAACAGGCAGGGGCAGG - Intronic
1097329712 12:58319451-58319473 ACTGAGTAACAGGCAGGGGATGG - Intergenic
1097973793 12:65663576-65663598 ACTCAAAATCAGGCAGCACAAGG + Intergenic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098070339 12:66667856-66667878 TTTGGAAATCAGGCAGAGGAAGG - Intronic
1099612127 12:84887476-84887498 ACTGAAAATCAGTCATAGAAAGG - Intronic
1100908304 12:99328133-99328155 ACTGAAAAGCAGGAAATGAAGGG + Intronic
1101388667 12:104280183-104280205 ACAGAAAATAAGGAAATGGAGGG - Intronic
1104145142 12:126026205-126026227 ACTTGAACCCAGGCAGTGGAGGG - Intergenic
1105484296 13:20811733-20811755 ACAGAAAACAAGGCAGTGGTGGG + Intronic
1106372845 13:29153419-29153441 GCTGAGAAACAGGCAGAGGAGGG - Intronic
1106799787 13:33244188-33244210 GCTGAAAATCAGGATGTGGGAGG + Intronic
1107379382 13:39839713-39839735 ACTCAAAAGTAGGCACTGGATGG - Intergenic
1108228257 13:48312847-48312869 TCTAAAAATCAGGCACAGGATGG - Intronic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1109589361 13:64457709-64457731 AGTGGATATTAGGCAGTGGAGGG + Intergenic
1111411096 13:87877676-87877698 ACTGAAAATGAGACTGTGCATGG - Intergenic
1111558832 13:89916824-89916846 ACCTAAAATGAGACAGTGGATGG - Intergenic
1111733715 13:92110241-92110263 ACTAAACACCAGGTAGTGGAAGG + Intronic
1112399377 13:99062638-99062660 GCAGAAAAGCAGGCAGCGGATGG - Intronic
1112972925 13:105283019-105283041 AATAAACATCAGGCAGTCGAAGG + Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1114535502 14:23419724-23419746 TCTGAGAACCAGGCAGAGGAAGG + Intronic
1114543810 14:23483528-23483550 AATAACAATCAGGCAGTAGAGGG - Intronic
1115571695 14:34672725-34672747 TCTGAAAACCAGGCAGTCGATGG - Intergenic
1117025660 14:51617290-51617312 ACTGAACAGCAGGGAGTGGGGGG + Intronic
1118230052 14:63939213-63939235 GCTGAAAATCAGGGGGTAGAGGG + Intronic
1118617376 14:67583692-67583714 AGTCAAAATCTGACAGTGGATGG - Intronic
1121303697 14:92891680-92891702 CCTGAATCTCAGGCACTGGAAGG + Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1122015964 14:98796854-98796876 TCTGTGAATCAGGCACTGGAGGG - Intergenic
1122930424 14:104930922-104930944 ACTGAGAAGTAGGCAGTGGTGGG - Exonic
1124166517 15:27330963-27330985 TCTGAAAATCAGGGAGTGGCAGG + Intronic
1125496285 15:40197482-40197504 ACAGAAAATGAGGTAGGGGAGGG + Intronic
1126190648 15:45874493-45874515 ACTGAGTAACAGGCAGAGGATGG - Intergenic
1127159295 15:56164638-56164660 AGTTAAAATCAGGCAAAGGAAGG - Intronic
1127969221 15:63945731-63945753 ACTGTAAGTCAGGCAGTGGATGG + Intronic
1129195583 15:73964120-73964142 ACAGAAAATCAGGCTGGGTATGG - Intergenic
1130090925 15:80820596-80820618 ACTGAGAATCAGAAAGTTGAGGG - Intronic
1132455791 16:22065-22087 AAAGAAAATCAGGCAGTGTGTGG + Intergenic
1133858022 16:9567791-9567813 ACTGTAAATCAGTCACTGGCAGG + Intergenic
1134235160 16:12459491-12459513 ACTGAAGAAGAGGAAGTGGATGG + Intronic
1134660689 16:15982169-15982191 ACTGAGTATCAGGCAGAGGCTGG - Intronic
1136237143 16:28921536-28921558 ACTGGAAAGGAGGCAGTGGGTGG + Intronic
1136412976 16:30087640-30087662 ACTAAGAGTCAGGCAGGGGAGGG - Intronic
1137540573 16:49358925-49358947 ACTCAGACTCAGGGAGTGGAGGG + Intergenic
1137672415 16:50286757-50286779 ACTGAAATTCAGAGAGAGGATGG + Intronic
1137723609 16:50642163-50642185 ACTGCTGATCAGGCAGGGGACGG + Intergenic
1138124460 16:54427299-54427321 ACAAAAAATCAGGAAGAGGACGG - Intergenic
1139553204 16:67688103-67688125 ACTGAAAACCATGAAGTAGAAGG + Intronic
1139597237 16:67965475-67965497 ATTGAAAACCATGCAGAGGAAGG - Intronic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1142511143 17:394247-394269 AGTGAAAATCAGGAAGCGGTTGG + Intergenic
1142696378 17:1636066-1636088 AGTGAAAGTCAGGGAGAGGAGGG - Intronic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG + Intergenic
1147436481 17:40419588-40419610 ACTGAAACCCAGGTAGAGGAAGG - Intergenic
1147637901 17:41975029-41975051 ACTGAACAGAGGGCAGTGGAGGG - Exonic
1149421574 17:56516102-56516124 TTTGAAAATCAGTCACTGGAGGG - Intergenic
1150446416 17:65230132-65230154 ACTGAAAAAGAGGCAATGGTGGG + Intergenic
1151964781 17:77425637-77425659 ACAGAGAAAGAGGCAGTGGAGGG - Intronic
1153369201 18:4294886-4294908 TCAGAGAATCAGCCAGTGGATGG - Intronic
1153472453 18:5462426-5462448 ACTAGAAAACAGGAAGTGGAAGG - Intronic
1155475170 18:26230508-26230530 TCTGAAAATCAAACAGTGGATGG - Intronic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1157155648 18:45262779-45262801 ACTGAACATCAAGGAGAGGATGG + Intronic
1157304044 18:46503746-46503768 CCAGAAAAGCATGCAGTGGAAGG - Intronic
1157410925 18:47462274-47462296 ACAGAAAATGAGGCACTGAAAGG - Intergenic
1158868714 18:61663149-61663171 ACTAAAAATTAGGCAGTTGCAGG - Intergenic
1159454010 18:68638435-68638457 AGGGAAGATCAGGCAGTGGGAGG + Intergenic
1160391087 18:78533754-78533776 ACTGAAGATCAGACAGGAGAGGG - Intergenic
1161194422 19:2978142-2978164 ACAGAAAATAAGGCAGTGCCAGG - Intronic
1163638278 19:18447633-18447655 TCTGGAAATCAGGGAGGGGAGGG + Intronic
1164779248 19:30879364-30879386 ACTGAGAAACAGGCAGGGCAAGG - Intergenic
1167096633 19:47378005-47378027 ACTGAAGCTCAGGCAGGGGCGGG + Intronic
1167775554 19:51552359-51552381 ACAGAATATCAGGCAGCTGATGG - Intergenic
1168467627 19:56616894-56616916 ATTGAATATCAGGCAATGAAGGG - Intronic
925019292 2:555955-555977 CAGGAAAATGAGGCAGTGGAAGG - Intergenic
925738569 2:6985462-6985484 ACTGATAATGAGTAAGTGGAAGG + Intronic
925906330 2:8541734-8541756 TCAGAGAACCAGGCAGTGGAAGG + Intergenic
925996721 2:9299564-9299586 ACAGGAAAGCAAGCAGTGGAAGG + Intronic
926364279 2:12118781-12118803 GGTGACAATCAGGCTGTGGAAGG - Intergenic
928431610 2:31223487-31223509 ACTTAAAATGAGGCAGAGTAGGG - Intronic
928563959 2:32523045-32523067 ACTGAGTATCAGGCAGGGCAGGG - Intronic
928898417 2:36292124-36292146 ACTGAAAATCAGTCATTCCAAGG - Intergenic
929653774 2:43708603-43708625 ACTGACAAACAGGCAGTAGGTGG - Intronic
930387496 2:50715357-50715379 ACTGAAGGTCAAGTAGTGGAAGG - Intronic
930481518 2:51953490-51953512 ACTGGAAAACAGGCAGTGGTTGG - Intergenic
930862512 2:56089638-56089660 TCTGAAAATAAGACAGAGGAAGG - Intergenic
931852280 2:66263711-66263733 ACTGTAAAGAAGTCAGTGGATGG - Intergenic
933368066 2:81379915-81379937 ACTGAACATCAGGCAGCAAATGG + Intergenic
933948732 2:87310090-87310112 ACTGGAAAGCAGGCAGGGAATGG - Intergenic
934074344 2:88415095-88415117 ATGCAAAAACAGGCAGTGGATGG + Intergenic
935413127 2:102786854-102786876 ACTCACAATCAGGAAGTGGAGGG + Intronic
936115549 2:109699954-109699976 ACTGAGCAACAGGCAGTGCAAGG - Intergenic
936261978 2:110967764-110967786 ACTGAAAAACAGGCACTGCTGGG + Intronic
936331466 2:111551506-111551528 ACTGGAAAGCAGGCAGGGAATGG + Intergenic
938998264 2:136703697-136703719 ACTGGAAAACAGGCACTGGATGG - Intergenic
939515252 2:143158784-143158806 ACAGAAAATCAGACAGCTGAGGG + Intronic
940605271 2:155916017-155916039 ACTGAAAACCAGGCTGGGCACGG + Intergenic
941424159 2:165321373-165321395 ACTGGATAACAGGCAGAGGATGG - Intronic
941702138 2:168614836-168614858 AGGGAGCATCAGGCAGTGGATGG - Intronic
942548487 2:177090167-177090189 ACAGAAAATCAAGTTGTGGAAGG + Intergenic
944975688 2:205047985-205048007 AATGAAATTGAGGCAGAGGAAGG + Intronic
946961776 2:224993061-224993083 ACTGAAAATCAGGCAGTGGAAGG + Intronic
948665691 2:239533403-239533425 ACTTAACATAAGGCAGTAGATGG - Intergenic
948754278 2:240150120-240150142 ACAGAAAATCAGGGTGTGCAGGG + Intergenic
1168864973 20:1078528-1078550 GCTGAAAATCAGGATGAGGAGGG + Intergenic
1168934045 20:1647597-1647619 ACTAACAATCCTGCAGTGGATGG - Intronic
1170951375 20:20939196-20939218 GCTGAAAATGAGGAAGTGGGGGG - Intergenic
1173367705 20:42402183-42402205 ACAGAAACTGAGGCAGTGGCTGG - Intronic
1173648323 20:44647537-44647559 ACTGAAGCTTAGGGAGTGGAGGG - Intronic
1177386058 21:20410815-20410837 ACTTAAAATCTGTAAGTGGAAGG - Intergenic
1177417497 21:20812956-20812978 ACTGCAAATCAGTCAGGGAACGG - Intergenic
1177867036 21:26524845-26524867 ACTGGAAATAAGGCTGTAGAGGG - Intronic
1178723818 21:35033860-35033882 ATTCAAAATCAGGCACTGGGAGG + Intronic
1178813537 21:35906199-35906221 ACTGAAAACCAGCCACTGGGAGG - Intronic
1179297303 21:40074894-40074916 TCAGAGAACCAGGCAGTGGAGGG + Intronic
1179652316 21:42819558-42819580 ACTAAAAATCAGGCTGGGCACGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184602208 22:45550347-45550369 TCTGAAGATCAGCCAGTGGAGGG + Intronic
1184701668 22:46178393-46178415 GCTGGACATCAGGCAGTGAAGGG + Intronic
949107219 3:214274-214296 ACTGAAAACCAGGCCCTAGAAGG - Intronic
950161377 3:10763681-10763703 GCTGAAAATGAGGCAGTTGTGGG - Intergenic
950394373 3:12722561-12722583 ATTGGACATCAGACAGTGGAAGG + Intergenic
951391832 3:22114547-22114569 AATGAAAAGAAGCCAGTGGAAGG + Intronic
951547377 3:23840896-23840918 ACTGGACATCAGGTAGTGCAAGG - Intronic
951610876 3:24491816-24491838 GCTGAAATTCAGGGAGTTGAAGG + Intronic
953057565 3:39400203-39400225 ACTAAAGATAAGGCAGTGTAGGG + Intergenic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
955216113 3:56986189-56986211 ACAAAAAATCAGGAAGTGCAGGG + Intronic
955251299 3:57285229-57285251 GCTGAAAATTAGGCTGTGCACGG - Intronic
955353944 3:58215161-58215183 ACCGAAAGCCAGGCAGTGCAAGG - Intergenic
958085753 3:88804206-88804228 AATGAGAATCAGGCAGAGGGAGG + Intergenic
959508313 3:107178963-107178985 ACTGAAAAACAGGCAGAGAGTGG - Intergenic
959695789 3:109247322-109247344 ACTGGATAACAGGCAGTGGTTGG - Intergenic
959704431 3:109326546-109326568 ACTAAAAATAATGCACTGGAAGG - Exonic
960192354 3:114722115-114722137 AGTGAGAATAAGGGAGTGGAGGG + Intronic
960691413 3:120349675-120349697 ACTGAAAAACAAGCGGGGGACGG - Intergenic
964089488 3:152857580-152857602 AGGGAAAATCAGGCAGAAGAAGG - Intergenic
966836461 3:184053112-184053134 ACTGACAGTGAGGCAGAGGAGGG - Exonic
967806238 3:193716791-193716813 ACTGGGAAGCAGGCAGTAGATGG - Intergenic
968197959 3:196725352-196725374 ATTGAATATCAGGCAATGAAGGG + Intronic
969186319 4:5477396-5477418 ACAGAAAATGAGGCATTTGAGGG - Intronic
969259324 4:6023589-6023611 ACTGAAATGTAGGCAGTTGAGGG - Intergenic
970049426 4:11897031-11897053 ACTGAATAACAGGCAGAGGGTGG + Intergenic
970351571 4:15206791-15206813 ACTGGATAACAGGCAGAGGATGG + Intergenic
971422744 4:26489099-26489121 ACAGAACATCAGGCTGTGCATGG - Intronic
972733461 4:41817482-41817504 ACTGAAGACCAGGCAGAGGCAGG - Intergenic
972876696 4:43370968-43370990 ACTAAAAATCAAGCAGGTGAAGG + Intergenic
973618692 4:52706140-52706162 GCTGAAAAACAGGCAGAGGTGGG - Intergenic
973908557 4:55555209-55555231 ACAGAGAATCATGAAGTGGAAGG - Intergenic
974127175 4:57710356-57710378 AGGAAAGATCAGGCAGTGGATGG - Intergenic
976519972 4:86015418-86015440 AGTGAAAGACAGGAAGTGGATGG - Intronic
976543357 4:86304120-86304142 ACTAAAAATAAGGCAGTAGGAGG + Intronic
977036286 4:91957841-91957863 ATTGAAATTCAGCCAGTGGAAGG - Intergenic
978283480 4:107045534-107045556 ACTCAAACCCAGGAAGTGGAGGG + Intronic
978549453 4:109909707-109909729 ACTGTGAATCAGGCAGGGCACGG - Intergenic
979369207 4:119863151-119863173 ACTGAAAAGCATCCATTGGAAGG + Intergenic
980104061 4:128570386-128570408 AATGAAAAACAGGCAATGGGAGG + Intergenic
980213208 4:129816566-129816588 ATTGAAAATCAGGCAACAGAAGG + Intergenic
981321444 4:143396387-143396409 GATGGAAATTAGGCAGTGGAAGG + Intronic
981650852 4:147056718-147056740 ACTGAAAATGATGCACTGAAAGG - Intergenic
981825897 4:148941032-148941054 ACAGAAGATCAGTCAGTGCATGG - Intergenic
981900631 4:149857860-149857882 AGTGAAAATCAGGCACTGTTTGG + Intergenic
982402971 4:154988807-154988829 ACAGAACATAAGGCAGAGGAAGG - Intergenic
982505040 4:156206396-156206418 ACTGAGTAACAGGCAGAGGATGG - Intergenic
982904385 4:161049360-161049382 ACTGAGAAACAGGCAGAGGTTGG - Intergenic
985263688 4:188138657-188138679 ACTGATAATCAGGGATTTGAAGG + Intergenic
987674285 5:21053966-21053988 ACTGAAGGTCAAGAAGTGGATGG + Intergenic
988439502 5:31216326-31216348 ACACAAAAGCAGGCAGTGGCTGG - Intronic
989445533 5:41524328-41524350 ACTGGAAGGCAGGAAGTGGAAGG - Intergenic
989446501 5:41535913-41535935 AAGGGCAATCAGGCAGTGGAAGG - Intergenic
989644979 5:43621381-43621403 AATGAAAATCAATCAGTTGAAGG + Intronic
990245449 5:53859469-53859491 AATGGAAATCACCCAGTGGAAGG + Intergenic
990247035 5:53873435-53873457 ACTGAAAATAATGCCATGGAAGG - Intergenic
992366877 5:76101178-76101200 ACAGAAACACAGGCAGTGGTGGG + Intronic
992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG + Intronic
995336080 5:111001382-111001404 ACTGAAAAGCAGGAAGGGCAAGG + Intergenic
995950019 5:117700792-117700814 ACTGAAAATGAGGGAGGTGAAGG - Intergenic
997696265 5:135863467-135863489 GCTGCAAATAAGGCAGAGGATGG + Intronic
999524705 5:152391991-152392013 ACTAAAAATCAGGCAGTCTTGGG + Exonic
1002598353 5:180338946-180338968 TCTGCAAATCAGGGAGTGCATGG - Intronic
1004576774 6:16903652-16903674 AATAAAAATCTGGCAGCGGATGG + Intergenic
1004930717 6:20460627-20460649 ACTGAAAAACATGCACAGGAAGG - Intronic
1006933489 6:37701501-37701523 TCTGAAAATCATACAGTGGCAGG + Intergenic
1007484867 6:42174022-42174044 ACTGTGAATCAGGCACTGGGGGG + Intronic
1007840228 6:44710166-44710188 ACTGATAATCAGGTAGAGGATGG + Intergenic
1008420551 6:51294224-51294246 AGTGAAAATCAGCAGGTGGATGG - Intergenic
1008964477 6:57300494-57300516 TCTGAAAATCGGGTAGTGGATGG + Intergenic
1011845268 6:91555203-91555225 ACTGAACATCAGGCAATTAAGGG + Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1013020237 6:106207670-106207692 GCTGAAAATCAGACAATGTATGG + Intronic
1013165128 6:107583216-107583238 ACTGGGCATCAGGCAGTGGCTGG + Intronic
1015079304 6:129204317-129204339 ACTGACAACCTGGCAGTGAAAGG + Intronic
1015549877 6:134401239-134401261 ACCCACAATCAGGGAGTGGAGGG + Intergenic
1015585405 6:134771058-134771080 ACTGAAAAGCAGGACGTGGCTGG - Intergenic
1016767544 6:147811743-147811765 ACTGAGAATGAGTCACTGGAAGG + Intergenic
1017590501 6:155974074-155974096 ACACAAAATCAGGAAGAGGAAGG + Intergenic
1018262241 6:161982071-161982093 ACTTACAATCAGGCAGAGAAGGG - Intronic
1019038369 6:169082402-169082424 ACTGCAAACCTGGCAGTGGAAGG + Intergenic
1019705899 7:2497278-2497300 ACTGAAAATCAGGCCATAGCAGG - Intergenic
1021632945 7:22664797-22664819 ATTGAAAGCCAGGCACTGGAAGG + Intergenic
1021901970 7:25294382-25294404 ATTGAACAGCAGGCAGTGGGTGG + Intergenic
1022596287 7:31716249-31716271 AATGAAAATAAGGCTGTGGAAGG - Intergenic
1022651280 7:32277924-32277946 CCAGAGAATCAGGCAGTGGGAGG + Intronic
1023076387 7:36486495-36486517 ACTCAAAGGCAGGCAGAGGAAGG - Intergenic
1024601042 7:50982015-50982037 ACTGTCAAACAGGCAGAGGATGG - Intergenic
1026304713 7:69130664-69130686 ACTGAAAATCACACAATGGCAGG + Intergenic
1027156490 7:75772003-75772025 CCTAAAAATCAGGGAGAGGAAGG + Exonic
1030333081 7:108294093-108294115 TCTTAAAATGAGGCAGTTGATGG + Intronic
1031358675 7:120820653-120820675 ACTGATGATCTAGCAGTGGAGGG - Intronic
1031827993 7:126589588-126589610 AGGGAAGATCAGGCAGTGGCTGG - Intronic
1033191790 7:139288047-139288069 ACAGAAAATCAGTAAGTTGAAGG - Intronic
1033445015 7:141413167-141413189 CCTGAATGTCAGGCAGAGGATGG - Intronic
1035819731 8:2578628-2578650 ACTGGGAAGCTGGCAGTGGATGG + Intergenic
1037512320 8:19596156-19596178 ACTGAAAATGAGGCTGGGCACGG - Intronic
1037791046 8:21942022-21942044 ACTTAACATCAGGGAGGGGAGGG + Intronic
1038181530 8:25233229-25233251 ACTGAACAGCAGGCAATGCAGGG - Intronic
1038512488 8:28152282-28152304 AGTGAAAAACAGGCAGAGAAGGG - Intronic
1038647032 8:29370517-29370539 TCTGGAATTCATGCAGTGGAGGG + Intergenic
1039378739 8:37064414-37064436 ACTTAAATTCAGGAAGTGTAAGG - Intergenic
1040774540 8:51024022-51024044 ACTGAAAATAAGACAGTGATGGG - Intergenic
1041346020 8:56898744-56898766 ACTCAAAGTCAGGCAGAGAAGGG - Intergenic
1041466229 8:58160098-58160120 ACTGAAACTAAGGGAGAGGAAGG - Intronic
1041568638 8:59310262-59310284 ACTGAGGCTCAGCCAGTGGAAGG + Intergenic
1041955783 8:63556832-63556854 ACTGCAATCCAGGCAGAGGATGG - Intergenic
1043157675 8:76805128-76805150 ACAGAAAATCAGGCAGCGTTAGG - Intronic
1047728768 8:127708345-127708367 GCTGAAAAGCAGGAACTGGAAGG + Intergenic
1051914936 9:22197412-22197434 ACTGAGAAACAGGCAGAGGTTGG + Intergenic
1054912702 9:70468455-70468477 AGTGAATTTCAGGCAGAGGAAGG - Intergenic
1055031224 9:71772715-71772737 ACTTAAAATCATGCAGGGGAGGG - Intronic
1058497048 9:105569829-105569851 AATTAAAATGAGGCAGTGGTTGG - Intronic
1059193868 9:112352452-112352474 ACTGAAAATTGGGAAGTGAAGGG - Intergenic
1059381610 9:113931403-113931425 GCTCAAAGTCAGGGAGTGGAGGG + Intronic
1059944008 9:119387783-119387805 ACTGAACAACAGGCAGTACAGGG + Intergenic
1060187494 9:121572678-121572700 CCTGAAAAACAGGCAGGGCAGGG - Intronic
1060597753 9:124858361-124858383 ACTGGGAATCGGGCAGTGGAAGG - Intronic
1186629117 X:11329423-11329445 ACTTAAAGTCAGGCAGGTGAGGG - Intronic
1188079935 X:25826572-25826594 CCTGAACATCAGGCAATGAAGGG + Intergenic
1188337034 X:28948985-28949007 ACGGAAAATGAAGCTGTGGATGG + Intronic
1188384744 X:29542309-29542331 ACTGGAAAGCAAGAAGTGGAAGG - Intronic
1188691977 X:33140532-33140554 ACTGAGAATCAGAAAATGGAGGG - Intronic
1189213215 X:39302039-39302061 ACTGGAAAACAGGCAGAGGTTGG + Intergenic
1189545713 X:42040699-42040721 ACAAAAAATCAGGCTGTGGTTGG + Intergenic
1189720999 X:43917532-43917554 ACTGGACATCAGGCTGTGCAGGG - Intergenic
1190342221 X:49306312-49306334 ACTGAGAATAAGGGAGTGGGAGG - Intronic
1190344479 X:49324659-49324681 ACTGAGAATAAGGGAGTGGGTGG - Intronic
1190345569 X:49334203-49334225 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1190346672 X:49343753-49343775 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1190347920 X:49534781-49534803 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1190349021 X:49544337-49544359 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1190350125 X:49553893-49553915 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1190351227 X:49563452-49563474 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1190352327 X:49573004-49573026 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1190353428 X:49582553-49582575 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1190354530 X:49592075-49592097 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1190355634 X:49601630-49601652 ACTGAGAATAAGGGAGTGGGCGG - Intronic
1192053016 X:67744583-67744605 TCTGAAAATCAGCCACAGGAGGG + Intergenic
1193273251 X:79554080-79554102 ACTGGAAAACAGGCAAAGGATGG + Intergenic
1195496745 X:105544801-105544823 ACTGAAAAGAATGCAGTGAAGGG - Intronic
1197193922 X:123679284-123679306 ACTGAAAATTAACCATTGGAGGG - Intronic
1198262364 X:134976254-134976276 ACTGATTATGTGGCAGTGGAGGG + Intergenic
1200046941 X:153408258-153408280 GCTGCCACTCAGGCAGTGGACGG + Intergenic
1200400580 X:156017660-156017682 AAAGAAAATCAGGCAGTGTGTGG - Intergenic