ID: 946964872

View in Genome Browser
Species Human (GRCh38)
Location 2:225027070-225027092
Sequence TTCCCTAGTACTGTGTACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946964872_946964874 9 Left 946964872 2:225027070-225027092 CCTCAGTACACAGTACTAGGGAA 0: 1
1: 0
2: 1
3: 8
4: 129
Right 946964874 2:225027102-225027124 AAAGAAGTACAGAGCCTTGTAGG 0: 1
1: 0
2: 9
3: 31
4: 249
946964872_946964876 26 Left 946964872 2:225027070-225027092 CCTCAGTACACAGTACTAGGGAA 0: 1
1: 0
2: 1
3: 8
4: 129
Right 946964876 2:225027119-225027141 TGTAGGTCTGAGATCCGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946964872 Original CRISPR TTCCCTAGTACTGTGTACTG AGG (reversed) Intronic
902604594 1:17561770-17561792 TTCCCTAATACGGTCTCCTGTGG + Intronic
906425048 1:45704722-45704744 TTTCCTAGCTCTGTTTACTGAGG + Intronic
906689240 1:47781769-47781791 TGCCCCAGAACTGTGTAATGCGG + Intronic
911607115 1:99919543-99919565 TTCCCTAGCCCTATCTACTGGGG - Intronic
917199646 1:172501018-172501040 TCCCCTAGAACTGGGGACTGAGG - Intergenic
919271802 1:195358437-195358459 TACCCTAGCACTGTATCCTGTGG - Intergenic
919605786 1:199681696-199681718 TTTCCTATTTCTGTGCACTGTGG - Intergenic
1064125063 10:12652292-12652314 TTCCCTAGGGCTGGGTGCTGTGG + Intronic
1067213941 10:44284820-44284842 TTCCCTAGTCCTGTCCCCTGAGG + Intergenic
1068880714 10:62045845-62045867 TTCCCTAATACTGTGATCAGTGG + Intronic
1070406739 10:76104313-76104335 TTCCCTTGCTCTGTGTCCTGGGG + Intronic
1070429580 10:76323882-76323904 TTGTCTTGTGCTGTGTACTGGGG - Intronic
1070625723 10:78049734-78049756 TGCCCTAGTACTGGGGCCTGTGG + Intronic
1071021140 10:81058716-81058738 TACCCTTGTATTGTGTCCTGGGG + Intergenic
1071727804 10:88217530-88217552 TTACCTAGTAATGTGTACCCGGG - Intergenic
1073192700 10:101663059-101663081 TTCCCATGTCCTGTGTGCTGAGG - Intronic
1076154545 10:128193548-128193570 TTCCCTAGTACTGAGACATGGGG + Intergenic
1078393726 11:10958786-10958808 TTCCCTAGGACTGTGCCCTGAGG - Intergenic
1080241488 11:30132116-30132138 GTGCTTAGTACTGAGTACTGGGG - Intergenic
1080473702 11:32570623-32570645 TTCCTTAGTTCTTTGTACAGTGG + Intergenic
1087758211 11:102077182-102077204 TTCCTCACTACTGTGTGCTGTGG + Intronic
1088281200 11:108136746-108136768 TTCACTTGTACTTTTTACTGGGG - Intronic
1089862900 11:121605851-121605873 TTTCCTAGTACTTGGTACTTAGG + Intronic
1094509861 12:31089747-31089769 CTCCCAAGTACTGCCTACTGTGG - Intronic
1096709027 12:53442062-53442084 TTCCCTGGAACTGAGTACGGAGG - Intronic
1099337210 12:81377819-81377841 TTCCTTACTTCAGTGTACTGGGG + Intronic
1101240920 12:102839281-102839303 TCCCCTAGTGCTTTGCACTGAGG - Intronic
1105400430 13:20089182-20089204 TTCCATTCTACTGTGTTCTGAGG + Exonic
1108748145 13:53416776-53416798 TTCCCTAATATTGTGCATTGAGG - Intergenic
1110210412 13:72965686-72965708 TTCCCTAGAACTCTTTAGTGTGG + Intronic
1115777497 14:36731811-36731833 TTCCCTGGTACTCTGTCCTGTGG + Intronic
1117652715 14:57923667-57923689 TTCCCTAGTTCTCTGTTTTGTGG + Intronic
1117806327 14:59495188-59495210 TTCATGAGTACAGTGTACTGTGG - Exonic
1118045813 14:61969960-61969982 TCCCCCAAGACTGTGTACTGGGG - Intergenic
1122072935 14:99216512-99216534 TTTCCCAGCACTGTGGACTGTGG + Intronic
1124943882 15:34244952-34244974 TTACCTGGCACTGTGTAATGTGG - Intronic
1125408733 15:39382564-39382586 TACACTGGTACTGTGTATTGTGG + Intergenic
1125891278 15:43268908-43268930 ACCCCCAGAACTGTGTACTGCGG + Intergenic
1126188886 15:45858672-45858694 TTCCCTAGTTCTTTGTAAAGTGG + Intergenic
1131287549 15:91074305-91074327 TTCCCTTGTGCTCTGTCCTGTGG + Intergenic
1132770018 16:1556681-1556703 ATCCCTGCTAGTGTGTACTGTGG - Intronic
1133904563 16:10010096-10010118 CTCCCTAGTACTGTGCCCTCAGG + Intronic
1138081969 16:54099409-54099431 TTCCATAGCATTGTGTGCTGGGG + Intronic
1140191760 16:72823501-72823523 TTACCTAGTTCTGTGTTCTTGGG - Intronic
1140752641 16:78039854-78039876 TTCACTTATACTGTGTACAGTGG + Intronic
1145998769 17:29119110-29119132 CTCCCTGGTCCTGGGTACTGGGG - Intronic
1146490481 17:33277943-33277965 TTCGCTTGTTCTTTGTACTGTGG - Intronic
1147886534 17:43688037-43688059 CTCCCTAGCACTGAGTACAGAGG + Intergenic
1149984447 17:61336623-61336645 ATCCTTTGTACTTTGTACTGGGG + Intronic
1153584097 18:6603399-6603421 TTCCCTCTTACTGTATCCTGTGG - Intergenic
1154044351 18:10890272-10890294 TGCCTTAGAAATGTGTACTGTGG - Intronic
1160844690 19:1161170-1161192 TGCCTGAGTACTGGGTACTGGGG + Intronic
1160844713 19:1161229-1161251 TGCCTGAGTACTGGGTACTGGGG + Intronic
1160844748 19:1161334-1161356 TGCCTGAGTACTGGGTACTGGGG + Intronic
1160844764 19:1161388-1161410 TGCCTGAGTACTGGGTACTGGGG + Intronic
1160844771 19:1161412-1161434 TGCCTGAGTACTGGGTACTGGGG + Intronic
1160857722 19:1224816-1224838 GTACCCAGTACTGAGTACTGAGG - Intronic
925769505 2:7268257-7268279 ATCCCTAGTACTGTGTGACGGGG + Intergenic
927084635 2:19662162-19662184 TTGCCTAGTATTCTGCACTGAGG - Intergenic
927226716 2:20773435-20773457 TCCTCTAGTACTGTGTCATGTGG - Intronic
931120253 2:59209859-59209881 TTCCCTACTAGATTGTACTGAGG - Intergenic
932930424 2:76030108-76030130 TTTCCTAGCACTATTTACTGAGG + Intergenic
935085954 2:99845527-99845549 TACCACAGTACTGTCTACTGGGG + Intronic
938577385 2:132617664-132617686 TTCCCTAGTTGTTTGTTCTGTGG + Intronic
943165716 2:184322771-184322793 TTGACTAATACTGTGTACTATGG - Intergenic
943612143 2:190045772-190045794 TTTCCTAGTAGTATGTACGGGGG + Intronic
943934837 2:193903067-193903089 TTTTCTAGAACTGTGCACTGTGG - Intergenic
944822766 2:203447338-203447360 TTTCCTAGTGCTGTCCACTGAGG - Exonic
946072953 2:217050130-217050152 TCCCCTAGAAATGTGTACTCAGG + Intergenic
946964872 2:225027070-225027092 TTCCCTAGTACTGTGTACTGAGG - Intronic
1169058391 20:2642312-2642334 TTCCCTTGGGCTGGGTACTGGGG - Intergenic
1169197866 20:3693054-3693076 GGCCCTGGTACTGTGCACTGTGG - Exonic
1169333633 20:4736930-4736952 TTCCCTATCACTGTAGACTGTGG - Intronic
1170119901 20:12900452-12900474 TTCCCTAGTACTGTGAAATCAGG - Intergenic
1177631931 21:23740282-23740304 TGTCCTAGTACTGTAGACTGAGG - Intergenic
1177650210 21:23950523-23950545 TTCCCTAGTTCTGTGATGTGTGG + Intergenic
1181596536 22:23918662-23918684 ATGCCTAGGACAGTGTACTGTGG + Intergenic
950482251 3:13251369-13251391 TTTCCTTGTATTGTGCACTGTGG + Intergenic
952137161 3:30436107-30436129 TTCCGTAGTTCTGTTTCCTGTGG + Intergenic
955233460 3:57119915-57119937 TTCCCTAGCACCCTGCACTGGGG + Intronic
956272373 3:67461812-67461834 TTCCCAGGTTCTGTGAACTGGGG - Intronic
956763431 3:72463612-72463634 TTCCCTAGTACTTAGTACACTGG - Intergenic
957710501 3:83851743-83851765 TTCCCTTTTACTGTGACCTGGGG + Intergenic
958492056 3:94788578-94788600 GTCCCTAGGACTGTGTAATATGG + Intergenic
962208697 3:133457887-133457909 TTCCCTACTGCTGGGCACTGAGG + Intronic
963277715 3:143349365-143349387 TTCCCTAGTTCTGTGGGATGAGG - Intronic
967850303 3:194077469-194077491 TTCCCCAGTACTGTTGCCTGGGG - Intergenic
970968352 4:21952687-21952709 TTTCCTAGTTCTGTGTCCTCCGG + Intergenic
971276853 4:25206486-25206508 TTCCCTAGTAATTTGTCCTATGG + Intronic
971612020 4:28737799-28737821 TTTCCTAGTACTGTTTGCTCAGG - Intergenic
972668531 4:41191531-41191553 TTTCCTAGTACTGTTTATTGAGG - Intronic
974910751 4:68116754-68116776 TTCCCTAATACTCTTTATTGAGG - Intronic
977344999 4:95806654-95806676 TTCTCTAGCACTGAGTCCTGTGG - Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
981349686 4:143714912-143714934 TTCCATAGTTCTATGTTCTGTGG - Intergenic
985844297 5:2333075-2333097 TTCCTTAGAACTGTGTACACAGG + Intergenic
989624830 5:43419357-43419379 TTCCCGAGTAGTGGGGACTGTGG + Intergenic
991009643 5:61869816-61869838 TTCCATAGCTCTGTCTACTGAGG - Intergenic
994291556 5:98033360-98033382 TTACCTGGTACTTTGCACTGGGG - Intergenic
998279085 5:140787662-140787684 TTCACGAATACTGTGTACTCGGG - Exonic
998279929 5:140796336-140796358 TTCACGAATACTGTGTACTCAGG - Exonic
1000918477 5:167110275-167110297 ATCCCTAGTCTTGTGTACTGGGG + Intergenic
1001383968 5:171323221-171323243 TTCCCTAGCACTGTTTGCTGGGG - Intergenic
1003950261 6:11109797-11109819 TATCCTAGTAGTGTGTCCTGTGG + Intronic
1006284165 6:33080523-33080545 TTTCCTAGTACCGAGTTCTGTGG - Intronic
1006306454 6:33223568-33223590 TTCCCCAGGACTGTTTATTGAGG - Intergenic
1007476743 6:42124307-42124329 TTCCCTTGTTCTGTGTGCTGTGG - Intronic
1009334121 6:62463985-62464007 TTCAGTTGTACTGTCTACTGGGG + Intergenic
1010510911 6:76718333-76718355 GTGCCTAGTACTGTATATTGAGG + Intergenic
1012735067 6:102928485-102928507 TTGCCTAGGACAGTGCACTGAGG - Intergenic
1012953330 6:105541878-105541900 TTCCATAGTACTTTATACTTAGG - Intergenic
1013816359 6:114103144-114103166 TTCCCTAGCAGTGTTTATTGAGG + Intronic
1014440835 6:121472051-121472073 TTCCCTAGTACTGTTTACTTAGG - Intergenic
1016953785 6:149607133-149607155 TCCCTTAGTACTGTGTTCTATGG - Intronic
1017940550 6:159049099-159049121 CTCCCTAGTTCTGTGTGCTCTGG + Intergenic
1020721171 7:11746989-11747011 TTCCATATTACTTTGTAATGTGG - Intronic
1020897819 7:13964109-13964131 TTCCCTAGTCCTTGGCACTGGGG - Intronic
1024396704 7:48877504-48877526 TCCCCTAGCATTCTGTACTGTGG + Intergenic
1027271252 7:76520293-76520315 TTCCCCAGGACTGTGTAGTTGGG + Intergenic
1029894173 7:103964205-103964227 TTCCTTAGTTCTGGGTATTGTGG + Intronic
1030219252 7:107079921-107079943 TTCCTGAGTAGTGTGTGCTGGGG + Intronic
1033303791 7:140209478-140209500 ATCCTTAGTACTGGGTTCTGTGG - Intergenic
1033892791 7:146035994-146036016 TTCCTTAAAACTGTGTTCTGTGG - Intergenic
1038791934 8:30675779-30675801 TTACCTAATAATGTGTAATGAGG + Intergenic
1044695711 8:94920566-94920588 TTCCCTTCTACTGCATACTGGGG - Intronic
1045072154 8:98519132-98519154 GTCCTTAGTTCTGTGGACTGAGG - Intronic
1051001469 9:12287726-12287748 TTCCTGAGTACTGCGCACTGCGG - Intergenic
1059708990 9:116850070-116850092 TTCCCAAGTCCAGTGTTCTGGGG + Intronic
1185932555 X:4219219-4219241 TTCTCTACCACTGAGTACTGGGG + Intergenic
1186529546 X:10281372-10281394 TTCCCTTGGACTTTGAACTGTGG - Intergenic
1188239859 X:27772762-27772784 TTCCCTATTACTGTTGAGTGGGG + Intergenic
1189557057 X:42155901-42155923 TTCTCTAGTTCTGTGTACCCAGG - Intergenic
1190116418 X:47628593-47628615 TTACCTACTACCGTGTAGTGTGG - Intronic
1191705685 X:64092257-64092279 TTCCCTAATATTGAGTCCTGAGG - Intergenic
1192807191 X:74521306-74521328 TTCCCTACCAATGTGTCCTGGGG - Intronic
1193610880 X:83630683-83630705 TTTCATAGTACTGTGAACAGTGG + Intergenic
1193692360 X:84661294-84661316 TTCCCTAGTGCTTTGTTCTGAGG + Intergenic
1195163886 X:102198347-102198369 TACCCAAGTACTGTCCACTGAGG + Intergenic
1195194975 X:102488748-102488770 TACCCAAGTACTGTCCACTGAGG - Intergenic