ID: 946966090

View in Genome Browser
Species Human (GRCh38)
Location 2:225039973-225039995
Sequence CTATGAGTCTGTACTGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946966085_946966090 20 Left 946966085 2:225039930-225039952 CCTTGCAATAGAGGATGGCTTGC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946966090 2:225039973-225039995 CTATGAGTCTGTACTGAAGTCGG 0: 1
1: 0
2: 0
3: 7
4: 100
946966087_946966090 -4 Left 946966087 2:225039954-225039976 CCAATACACACCCGCGGTTCTAT 0: 1
1: 0
2: 0
3: 1
4: 21
Right 946966090 2:225039973-225039995 CTATGAGTCTGTACTGAAGTCGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946966090 Original CRISPR CTATGAGTCTGTACTGAAGT CGG Intronic
904822479 1:33255293-33255315 CTATGAATATTTACTGAATTTGG + Intergenic
907680077 1:56554874-56554896 CTATGAGTGTGAAGTGAACTTGG - Intronic
910009006 1:82437380-82437402 CTATGAGCCTCTGCTGAACTGGG + Intergenic
913558108 1:119989890-119989912 CTGTCAGACTGTTCTGAAGTGGG - Intronic
913639735 1:120800562-120800584 CTGTCAGACTGTTCTGAAGTGGG + Intergenic
914278742 1:146149779-146149801 CTGTCAGACTGTTCTGAAGTGGG - Intronic
914539789 1:148600721-148600743 CTGTCAGACTGTTCTGAAGTGGG - Intronic
914626885 1:149470897-149470919 CTGTCAGACTGTTCTGAAGTGGG + Intergenic
922205274 1:223441010-223441032 CAATGAGGCTATACTGGAGTAGG - Intergenic
922400604 1:225250414-225250436 CTTACAGTCTGTACAGAAGTAGG - Intronic
1066815305 10:39401019-39401041 CTATGAGGCTGTAGTGAAAAAGG + Intergenic
1069935516 10:71913041-71913063 CTCAGTGTGTGTACTGAAGTTGG + Intergenic
1074914915 10:117946105-117946127 CAATGAAAGTGTACTGAAGTAGG + Intergenic
1085452195 11:76641141-76641163 CTATGAGGCTACACTGAAGTAGG + Intergenic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1095638025 12:44454723-44454745 CTATCAGACTGTACAGAGGTGGG - Intergenic
1098377937 12:69837346-69837368 CTTTGACTCTGTCCTGAAGAGGG - Intronic
1104896750 12:132168559-132168581 GTCTGGGTCTGTACTGCAGTCGG - Intergenic
1112136282 13:96581855-96581877 CTGAGAGTTTGTACTGAAGTGGG + Intronic
1117030688 14:51666533-51666555 CTAGGAGTGGGGACTGAAGTGGG + Intronic
1117574840 14:57087489-57087511 CTAAGACTCTGTACGGAAGGGGG + Intergenic
1121413384 14:93762837-93762859 CTATGTGCCTGGAGTGAAGTTGG - Intronic
1128937071 15:71755985-71756007 CTCTGAGTCTGTCCAGAAGGAGG + Intronic
1133562842 16:6965809-6965831 CTTTTAATCTGTACTGAAATAGG + Intronic
1136286868 16:29249280-29249302 CGATGAGATTGTTCTGAAGTAGG - Intergenic
1138286064 16:55811131-55811153 GCATGAGTCTTTACTGAAATGGG + Intronic
1139056963 16:63197324-63197346 ATATGAGTCTGTAATTTAGTTGG + Intergenic
1142092467 16:88221915-88221937 CGATGAGATTGTTCTGAAGTAGG - Intergenic
1145813589 17:27780228-27780250 CTGTGAGTCAGGACTGAATTTGG + Intronic
1146269768 17:31477199-31477221 CTCTGAGTCTGTTCTGGGGTTGG - Intronic
1148074265 17:44926549-44926571 CTATGGGTGTGCATTGAAGTGGG + Intronic
1151310227 17:73288231-73288253 CTAGAAGTTTGTACTGCAGTGGG - Intronic
1151380575 17:73723007-73723029 CAGTGAGACTGTACTGCAGTTGG + Intergenic
1155013544 18:21807909-21807931 CTATGAGTATTAATTGAAGTGGG - Intronic
1156925931 18:42579017-42579039 CTATGAGTCAATGCTGAAGGTGG - Intergenic
1157043526 18:44067283-44067305 TTATGATTATGTACTGGAGTTGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1165921906 19:39304296-39304318 CAGTGTGTCTGGACTGAAGTGGG - Intergenic
1166878263 19:45911481-45911503 CAGGGAGTCTGGACTGAAGTAGG - Intergenic
926780369 2:16465697-16465719 CTATGACTCTGCACTCAACTGGG + Intergenic
927422879 2:22951485-22951507 CTGTGAGACTGTACTCAACTTGG - Intergenic
929317324 2:40495407-40495429 CTAAGAGTTTGTCCTGAACTCGG - Intronic
931626007 2:64256261-64256283 TTATCAGACTGTACTGAGGTGGG - Intergenic
935880516 2:107560156-107560178 CTATGAGTCTGTGGTGCTGTAGG - Intergenic
939979178 2:148758142-148758164 CCATGAGTCCATACTGATGTGGG + Intronic
941306717 2:163878604-163878626 CTTTGAGTTTGTTCTGAAGGTGG + Intergenic
941341726 2:164314002-164314024 GTCTGAGTGTGTGCTGAAGTGGG - Intergenic
943370663 2:187011563-187011585 CAATCTGTGTGTACTGAAGTAGG + Intergenic
943644678 2:190397307-190397329 CTATGATTCTGGACTGGAGTTGG + Intergenic
946966090 2:225039973-225039995 CTATGAGTCTGTACTGAAGTCGG + Intronic
947157940 2:227182301-227182323 CTATGAATCTGGAATGAGGTGGG + Intronic
1173343192 20:42173277-42173299 CTATGTGTCTGGAGTGAACTGGG + Intronic
1174753588 20:53136535-53136557 TTAAGAGTGTCTACTGAAGTGGG - Intronic
1177518459 21:22185757-22185779 CTATGAGTATTCACTGAACTGGG + Intergenic
1178965522 21:37113326-37113348 CTCTGAGACTTTGCTGAAGTTGG - Intronic
1179318709 21:40269819-40269841 AGATGAGGCTCTACTGAAGTAGG - Intronic
1180568980 22:16698348-16698370 CTATGTGTGTGTTTTGAAGTGGG - Intergenic
1181588005 22:23864647-23864669 GTCTGAGTGTGCACTGAAGTGGG - Intronic
949497226 3:4644034-4644056 ATATGAGTCTGTGCTGAAGAAGG - Intronic
953494963 3:43377983-43378005 CCATGAGTCGGGACTGCAGTGGG - Intronic
955002910 3:54943760-54943782 CTATTAGTCCGGACTGAAATAGG - Intronic
956320489 3:67991309-67991331 CCATGAATCTGTACTCAAATGGG - Intergenic
957214232 3:77298533-77298555 ATATGAGACTGAACTGAAGTGGG + Intronic
970616975 4:17776901-17776923 CTAGGAGATTGTGCTGAAGTAGG + Intronic
975092147 4:70416535-70416557 CTATGAGTTTGAACTGATGAAGG - Intergenic
975514637 4:75233008-75233030 CTAGAAGTCTGTATTGAACTTGG + Intergenic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
979121489 4:116907972-116907994 TTATGTCACTGTACTGAAGTTGG - Intergenic
981991686 4:150928887-150928909 CTTCAAGTCTGCACTGAAGTAGG - Exonic
983478801 4:168247728-168247750 CTATGGGACAGTAATGAAGTGGG + Intronic
986869673 5:12031535-12031557 CTATGAGGCTGTACCCCAGTGGG - Intergenic
987297780 5:16569188-16569210 CTAAGAGACTCTACTGAAGGAGG + Intronic
987348607 5:17000839-17000861 CAAAATGTCTGTACTGAAGTGGG + Intergenic
989643020 5:43602081-43602103 CTGTGAGTTTGGACTGCAGTGGG + Intergenic
995768185 5:115641043-115641065 CTATGAGGCTGCAGTCAAGTTGG - Intergenic
995991285 5:118242746-118242768 CTATGAGTTGGTAATGAAGAAGG - Intergenic
996219543 5:120913339-120913361 CTATGAGACTGCACTGTACTTGG - Intergenic
997120665 5:131169770-131169792 CTATGAGTCTACACTGAAAATGG + Intronic
997733771 5:136198907-136198929 CTCTGAGTCTGGGCTGAAGTGGG + Intergenic
1002948141 6:1782129-1782151 CTGTGAGTCTGGACTAAACTGGG - Intronic
1007739057 6:44000189-44000211 CCAGGAGTCTGAACTGAAGATGG - Intergenic
1008037029 6:46756324-46756346 CTTTGAGTTTGTACTAAATTTGG + Intronic
1008808065 6:55455877-55455899 CTATGAATACGTACTGAAGTTGG + Intronic
1010925885 6:81745431-81745453 CCATGAGTCTCTACTGATATCGG + Intronic
1012303055 6:97613595-97613617 CTATGTGTCTGTATTTATGTTGG + Intergenic
1014350003 6:120329369-120329391 CAAGGAGTCTGTACTCTAGTAGG + Intergenic
1017161748 6:151371942-151371964 CTTTGAGGATGTACTGAATTAGG - Intronic
1021695761 7:23274666-23274688 TCATGAGTGTGTATTGAAGTGGG - Exonic
1022056215 7:26737294-26737316 CTAAGGGTCAGTAGTGAAGTAGG - Intronic
1023968144 7:44974043-44974065 CAGTGAGTCTGCACTGAGGTGGG - Intronic
1025240125 7:57264827-57264849 CCATGGTTCTGGACTGAAGTTGG - Intergenic
1030652481 7:112130256-112130278 ATATGAGCCTGGAATGAAGTGGG + Intronic
1031244120 7:119285104-119285126 CTATGAGTACGTTCTGAGGTGGG - Intergenic
1036479123 8:9122194-9122216 CCATGAGTATGTTCTGAACTGGG + Intergenic
1041256660 8:55984608-55984630 CTTTGAGTGTGTATTCAAGTTGG - Intronic
1041776309 8:61526945-61526967 CTTTGTCTCTGTCCTGAAGTAGG - Intronic
1044226599 8:89726055-89726077 TTTTGAGTCAGTTCTGAAGTAGG - Intergenic
1045639019 8:104226509-104226531 CAATGAGTCTCTAATGAATTAGG + Intronic
1045897784 8:107239416-107239438 ATATGAGTCTGAACTCAAGCAGG - Intergenic
1048668539 8:136691208-136691230 ATATGAGAATGGACTGAAGTTGG + Intergenic
1054338041 9:63826406-63826428 CTATGAGCATCTAGTGAAGTAGG - Intergenic
1057865327 9:98675597-98675619 CTATGTGTCTATTCTGAAGGTGG + Intronic
1060351352 9:122863548-122863570 ATATGAAACAGTACTGAAGTTGG - Intronic
1060870208 9:127033920-127033942 CTCAGATTCTGTCCTGAAGTTGG - Intronic
1189046942 X:37603409-37603431 TTTTGTGTCTGTACAGAAGTTGG + Intronic
1192115184 X:68403662-68403684 CTGTGAGTCTCTACAGCAGTAGG - Intronic
1194517455 X:94872985-94873007 ATATTAGTGTGTACTGATGTTGG - Intergenic