ID: 946969893

View in Genome Browser
Species Human (GRCh38)
Location 2:225079923-225079945
Sequence CAGGGCAAACAGTTTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946969893_946969898 10 Left 946969893 2:225079923-225079945 CCTTGCACAAACTGTTTGCCCTG No data
Right 946969898 2:225079956-225079978 ACTTCCTTCTTGTCTTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946969893 Original CRISPR CAGGGCAAACAGTTTGTGCA AGG (reversed) Intergenic
No off target data available for this crispr