ID: 946973972

View in Genome Browser
Species Human (GRCh38)
Location 2:225127247-225127269
Sequence TCTCCCATACTGTAGGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946973970_946973972 11 Left 946973970 2:225127213-225127235 CCTTTGTCAGATGGGTAGTAGAT No data
Right 946973972 2:225127247-225127269 TCTCCCATACTGTAGGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946973972 Original CRISPR TCTCCCATACTGTAGGTTGT AGG Intergenic
No off target data available for this crispr