ID: 946978121

View in Genome Browser
Species Human (GRCh38)
Location 2:225175751-225175773
Sequence CTGTAAGTAGGGAAGGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946978116_946978121 12 Left 946978116 2:225175716-225175738 CCACTATTAGCAAGAATCTCAGT No data
Right 946978121 2:225175751-225175773 CTGTAAGTAGGGAAGGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946978121 Original CRISPR CTGTAAGTAGGGAAGGTAGT AGG Intergenic
No off target data available for this crispr