ID: 946982761

View in Genome Browser
Species Human (GRCh38)
Location 2:225235985-225236007
Sequence TGGGGTCTTCAGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946982761_946982768 22 Left 946982761 2:225235985-225236007 CCATTCTCATTCTGAAGACCCCA No data
Right 946982768 2:225236030-225236052 TTCCAGTTTCACTTAGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946982761 Original CRISPR TGGGGTCTTCAGAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr