ID: 946986080

View in Genome Browser
Species Human (GRCh38)
Location 2:225274978-225275000
Sequence GGCCACTGGCCAAGATGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946986080_946986088 14 Left 946986080 2:225274978-225275000 CCAGAACATCTTGGCCAGTGGCC No data
Right 946986088 2:225275015-225275037 TAGTGAATCCCTGGGGTGTGGGG No data
946986080_946986087 13 Left 946986080 2:225274978-225275000 CCAGAACATCTTGGCCAGTGGCC No data
Right 946986087 2:225275014-225275036 CTAGTGAATCCCTGGGGTGTGGG No data
946986080_946986083 5 Left 946986080 2:225274978-225275000 CCAGAACATCTTGGCCAGTGGCC No data
Right 946986083 2:225275006-225275028 ATTAAGCACTAGTGAATCCCTGG No data
946986080_946986085 7 Left 946986080 2:225274978-225275000 CCAGAACATCTTGGCCAGTGGCC No data
Right 946986085 2:225275008-225275030 TAAGCACTAGTGAATCCCTGGGG No data
946986080_946986084 6 Left 946986080 2:225274978-225275000 CCAGAACATCTTGGCCAGTGGCC No data
Right 946986084 2:225275007-225275029 TTAAGCACTAGTGAATCCCTGGG No data
946986080_946986086 12 Left 946986080 2:225274978-225275000 CCAGAACATCTTGGCCAGTGGCC No data
Right 946986086 2:225275013-225275035 ACTAGTGAATCCCTGGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946986080 Original CRISPR GGCCACTGGCCAAGATGTTC TGG (reversed) Intergenic
No off target data available for this crispr