ID: 946993613

View in Genome Browser
Species Human (GRCh38)
Location 2:225364778-225364800
Sequence TATTTTGCAAAGAAGGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946993610_946993613 21 Left 946993610 2:225364734-225364756 CCTTAACTGACTGTAGCAATTTA No data
Right 946993613 2:225364778-225364800 TATTTTGCAAAGAAGGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946993613 Original CRISPR TATTTTGCAAAGAAGGCTCA AGG Intergenic
No off target data available for this crispr