ID: 946994539

View in Genome Browser
Species Human (GRCh38)
Location 2:225376407-225376429
Sequence TCTCTACTCAAGGGTGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946994539_946994544 1 Left 946994539 2:225376407-225376429 CCAATTCCACCCTTGAGTAGAGA No data
Right 946994544 2:225376431-225376453 AACCTTGCTCTCCCCTTGAAGGG No data
946994539_946994543 0 Left 946994539 2:225376407-225376429 CCAATTCCACCCTTGAGTAGAGA No data
Right 946994543 2:225376430-225376452 CAACCTTGCTCTCCCCTTGAAGG No data
946994539_946994545 2 Left 946994539 2:225376407-225376429 CCAATTCCACCCTTGAGTAGAGA No data
Right 946994545 2:225376432-225376454 ACCTTGCTCTCCCCTTGAAGGGG No data
946994539_946994547 9 Left 946994539 2:225376407-225376429 CCAATTCCACCCTTGAGTAGAGA No data
Right 946994547 2:225376439-225376461 TCTCCCCTTGAAGGGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946994539 Original CRISPR TCTCTACTCAAGGGTGGAAT TGG (reversed) Intergenic
No off target data available for this crispr