ID: 946994541

View in Genome Browser
Species Human (GRCh38)
Location 2:225376416-225376438
Sequence GCAAGGTTGTCTCTACTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946994541_946994545 -7 Left 946994541 2:225376416-225376438 CCCTTGAGTAGAGACAACCTTGC No data
Right 946994545 2:225376432-225376454 ACCTTGCTCTCCCCTTGAAGGGG No data
946994541_946994547 0 Left 946994541 2:225376416-225376438 CCCTTGAGTAGAGACAACCTTGC No data
Right 946994547 2:225376439-225376461 TCTCCCCTTGAAGGGGATTTTGG No data
946994541_946994543 -9 Left 946994541 2:225376416-225376438 CCCTTGAGTAGAGACAACCTTGC No data
Right 946994543 2:225376430-225376452 CAACCTTGCTCTCCCCTTGAAGG No data
946994541_946994544 -8 Left 946994541 2:225376416-225376438 CCCTTGAGTAGAGACAACCTTGC No data
Right 946994544 2:225376431-225376453 AACCTTGCTCTCCCCTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946994541 Original CRISPR GCAAGGTTGTCTCTACTCAA GGG (reversed) Intergenic
No off target data available for this crispr