ID: 946994542

View in Genome Browser
Species Human (GRCh38)
Location 2:225376417-225376439
Sequence AGCAAGGTTGTCTCTACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946994542_946994547 -1 Left 946994542 2:225376417-225376439 CCTTGAGTAGAGACAACCTTGCT No data
Right 946994547 2:225376439-225376461 TCTCCCCTTGAAGGGGATTTTGG No data
946994542_946994543 -10 Left 946994542 2:225376417-225376439 CCTTGAGTAGAGACAACCTTGCT No data
Right 946994543 2:225376430-225376452 CAACCTTGCTCTCCCCTTGAAGG No data
946994542_946994544 -9 Left 946994542 2:225376417-225376439 CCTTGAGTAGAGACAACCTTGCT No data
Right 946994544 2:225376431-225376453 AACCTTGCTCTCCCCTTGAAGGG No data
946994542_946994545 -8 Left 946994542 2:225376417-225376439 CCTTGAGTAGAGACAACCTTGCT No data
Right 946994545 2:225376432-225376454 ACCTTGCTCTCCCCTTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946994542 Original CRISPR AGCAAGGTTGTCTCTACTCA AGG (reversed) Intergenic
No off target data available for this crispr