ID: 946994543

View in Genome Browser
Species Human (GRCh38)
Location 2:225376430-225376452
Sequence CAACCTTGCTCTCCCCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946994539_946994543 0 Left 946994539 2:225376407-225376429 CCAATTCCACCCTTGAGTAGAGA No data
Right 946994543 2:225376430-225376452 CAACCTTGCTCTCCCCTTGAAGG No data
946994541_946994543 -9 Left 946994541 2:225376416-225376438 CCCTTGAGTAGAGACAACCTTGC No data
Right 946994543 2:225376430-225376452 CAACCTTGCTCTCCCCTTGAAGG No data
946994540_946994543 -6 Left 946994540 2:225376413-225376435 CCACCCTTGAGTAGAGACAACCT No data
Right 946994543 2:225376430-225376452 CAACCTTGCTCTCCCCTTGAAGG No data
946994542_946994543 -10 Left 946994542 2:225376417-225376439 CCTTGAGTAGAGACAACCTTGCT No data
Right 946994543 2:225376430-225376452 CAACCTTGCTCTCCCCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946994543 Original CRISPR CAACCTTGCTCTCCCCTTGA AGG Intergenic
No off target data available for this crispr